Miyakogusa Predicted Gene

chr3.CM0160.970.nd
Show Alignment:  

BLASTN 2.2.18 [Mar-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr3.CM0160.970.nd
         (3358 letters)

Database: lotus_EST_unigene 
           20,423 sequences; 9,996,863 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

AV772572  MPD038a11_f                                                  86   5e-16
AV777755  MPDL025d08_f                                                 66   5e-10

>AV772572  MPD038a11_f;
          Length = 491

 Score = 85.7 bits (43), Expect = 5e-16
 Identities = 55/59 (93%)
 Strand = Plus / Minus

                                                                       
Query: 1062 atcaagaagcacttctgcaggaagcacggggagaagaagtggaagtgcgagaagtgctc 1120
            ||||||||||||||| |||| |||||||| ||||||||||||||||| |||||||||||
Sbjct: 261  atcaagaagcacttcagcagaaagcacggtgagaagaagtggaagtgtgagaagtgctc 203


>AV777755  MPDL025d08_f;
          Length = 401

 Score = 65.9 bits (33), Expect = 5e-10
 Identities = 120/149 (80%)
 Strand = Plus / Plus

                                                                       
Query: 843 tcaccaaagactctgatggccaccaacagattcgtgtgtgagatttgtctaaagggtttc 902
           ||||| ||||| |||||||| || |||||||| || ||||| || ||    ||||| || 
Sbjct: 210 tcaccgaagaccctgatggcgacgaacagatttgtatgtgaaatatgcaacaaggggttt 269

                                                                       
Query: 903 caaagggatcagaatctccaactgcaccgacgcggccataaccttccatggaagctcaag 962
           || |||||||||||||| || || || ||||| || || || || ||||||||||| | |
Sbjct: 270 cagagggatcagaatcttcagctccatcgacgggggcacaatctgccatggaagctgagg 329

                                        
Query: 963 cagaggacaagcaaagaagtgaggaagag 991
           |||||| ||||||| || |||||||||||
Sbjct: 330 cagaggtcaagcaaggaggtgaggaagag 358