Miyakogusa Predicted Gene

chr2.LjT30P12.40.nc
Show Alignment:  

BLASTN 2.2.18 [Mar-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr2.LjT30P12.40.nc
         (1585 letters)

Database: lotus_EST_unigene 
           20,423 sequences; 9,996,863 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KMC017961A_C01 KMC017961A_c01                                          46   2e-04

>KMC017961A_C01 KMC017961A_c01;
          Length = 605

 Score = 46.1 bits (23), Expect = 2e-04
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 1553 attaaggggttgtctaaatgactcatg 1579
            |||| ||||||||||||||||||||||
Sbjct: 148  attatggggttgtctaaatgactcatg 122