Miyakogusa Predicted Gene
- chr2.CM0021.1090.nc
BLASTN 2.2.18 [Mar-02-2008]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= chr2.CM0021.1090.nc
(11,160 letters)
Database: lotus_EST_unigene
20,423 sequences; 9,996,863 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
BP064214 GENLf036a11 76 2e-12
KMC021317A_C01 KMC021317A_c01 68 4e-10
BP055633 SPDL058d09_f 64 6e-09
>BP064214 GENLf036a11;
Length = 534
Score = 75.8 bits (38), Expect = 2e-12
Identities = 69/78 (88%), Gaps = 1/78 (1%)
Strand = Plus / Plus
Query: 10835 ctctcccaagtcccaatttcccaaa-tgttcacaaagatacctaaaccctcttcacactc 10893
|||| ||||||||||||| || ||| || || ||||||||||||| |||||||||||||
Sbjct: 134 ctcttccaagtcccaattgcctaaagtgatccaaaagatacctaaaacctcttcacactc 193
Query: 10894 ccttatttataggctaag 10911
||||| ||||||||||||
Sbjct: 194 ccttaattataggctaag 211
>KMC021317A_C01 KMC021317A_c01;
Length = 550
Score = 67.9 bits (34), Expect = 4e-10
Identities = 34/34 (100%)
Strand = Plus / Minus
Query: 10995 cccccctaaacatccaccttgtcctcaaggtggg 11028
||||||||||||||||||||||||||||||||||
Sbjct: 83 cccccctaaacatccaccttgtcctcaaggtggg 50
Score = 58.0 bits (29), Expect = 4e-07
Identities = 78/93 (83%), Gaps = 1/93 (1%)
Strand = Plus / Minus
Query: 10818 attcgagagactcatcactctcccaagtcccaatttcccaaatgttcac-aaagatacct 10876
||||||||| ||| | ||||||||||||||||||||| ||||| || | |||||| |||
Sbjct: 242 attcgagaggctctgctctctcccaagtcccaatttcctaaatgatcccaaaagatgcct 183
Query: 10877 aaaccctcttcacactcccttatttataggcta 10909
|||| ||| | || |||||||||| |||||||
Sbjct: 182 aaactctcctagcaatcccttatttgtaggcta 150
>BP055633 SPDL058d09_f;
Length = 528
Score = 63.9 bits (32), Expect = 6e-09
Identities = 44/48 (91%)
Strand = Plus / Plus
Query: 10766 tgatggaaccctgatattattcaaccaagaaatgtacaagaaacagat 10813
||||| ||||||||||||||||||| | |||||||||||||||||||
Sbjct: 106 tgatgaaaccctgatattattcaacagaaaaatgtacaagaaacagat 153