Miyakogusa Predicted Gene
- chr6.LjT36O06.80.nd
BLASTN 2.2.13 [Nov-27-2005]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= chr6.LjT36O06.80.nd - phase: 0
(1980 letters)
Database: lotus_consensus
8469 sequences; 5,164,774 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
KMC003985A_C01 KMC003985A_c01 58 3e-08
>KMC003985A_C01 KMC003985A_c01
Length = 801
Score = 58.0 bits (29), Expect = 3e-08
Identities = 68/81 (83%)
Strand = Plus / Minus
Query: 1840 acagttggctcaatgcaagtcaaagttaatgggcttgctgcatcttctggtctcttgaag 1899
||||| |||||||||||||||| ||||||||| | || ||||||||| | ||||||
Sbjct: 688 acagtaggctcaatgcaagtcagagttaatggattcagtgagtcttctggttttttgaag 629
Query: 1900 gttggcagtatcccacttgat 1920
||||| || ||||||||||||
Sbjct: 628 gttgggagcatcccacttgat 608
Score = 56.0 bits (28), Expect = 1e-07
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 1747 gatatttcctccatcttaaagattggttcagtcactattacccc 1790
|||||||| || |||||||||||||||||||||| ||||||||
Sbjct: 796 gatatttcttctgtcttaaagattggttcagtcaccattacccc 753
Database: lotus_consensus
Posted date: Nov 10, 2006 2:59 PM
Number of letters in database: 5,164,774
Number of sequences in database: 8469
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7673
Number of Sequences: 8469
Number of extensions: 7673
Number of successful extensions: 2148
Number of sequences better than 1.0e-03: 1
Number of HSP's better than 0.0 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 2144
Number of HSP's gapped (non-prelim): 4
length of query: 1980
length of database: 5,164,774
effective HSP length: 17
effective length of query: 1963
effective length of database: 5,020,801
effective search space: 9855832363
effective search space used: 9855832363
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 22 (44.1 bits)