Miyakogusa Predicted Gene
- chr6.LjT36L14.10.nd
BLASTN 2.2.13 [Nov-27-2005]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= chr6.LjT36L14.10.nd + phase: 0 /partial
(777 letters)
Database: lotus_consensus
8469 sequences; 5,164,774 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
KMC004603A_C01 KMC004603A_c01 135 7e-32
KMC004491A_C01 KMC004491A_c01 42 8e-04
>KMC004603A_C01 KMC004603A_c01
Length = 503
Score = 135 bits (68), Expect = 7e-32
Identities = 68/68 (100%)
Strand = Plus / Minus
Query: 710 tttctgccgttccctctagttattgtagtgggcagcttgatccccggaaagttcttcagg 769
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 503 tttctgccgttccctctagttattgtagtgggcagcttgatccccggaaagttcttcagg 444
Query: 770 gcagcagg 777
||||||||
Sbjct: 443 gcagcagg 436
>KMC004491A_C01 KMC004491A_c01
Length = 532
Score = 42.1 bits (21), Expect = 8e-04
Identities = 36/41 (87%)
Strand = Plus / Minus
Query: 421 cgctttactgaacagggggatgctttaacatttgaatcaga 461
||||| || ||||| || |||||||| ||||||||||||||
Sbjct: 530 cgcttcacagaacaaggagatgctttgacatttgaatcaga 490
Database: lotus_consensus
Posted date: Nov 10, 2006 2:59 PM
Number of letters in database: 5,164,774
Number of sequences in database: 8469
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3030
Number of Sequences: 8469
Number of extensions: 3030
Number of successful extensions: 862
Number of sequences better than 1.0e-03: 2
Number of HSP's better than 0.0 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 858
Number of HSP's gapped (non-prelim): 4
length of query: 777
length of database: 5,164,774
effective HSP length: 16
effective length of query: 761
effective length of database: 5,029,270
effective search space: 3827274470
effective search space used: 3827274470
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)