Miyakogusa Predicted Gene

chr6.LjT36L14.10.nd
Show Alignment: 

BLASTN 2.2.13 [Nov-27-2005]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr6.LjT36L14.10.nd + phase: 0 /partial
         (777 letters)

Database: lotus_consensus 
           8469 sequences; 5,164,774 total letters

Searching..................................................done

                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KMC004603A_C01 KMC004603A_c01                                         135   7e-32
KMC004491A_C01 KMC004491A_c01                                          42   8e-04

>KMC004603A_C01 KMC004603A_c01
          Length = 503

 Score =  135 bits (68), Expect = 7e-32
 Identities = 68/68 (100%)
 Strand = Plus / Minus

                                                                       
Query: 710 tttctgccgttccctctagttattgtagtgggcagcttgatccccggaaagttcttcagg 769
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 503 tttctgccgttccctctagttattgtagtgggcagcttgatccccggaaagttcttcagg 444

                   
Query: 770 gcagcagg 777
           ||||||||
Sbjct: 443 gcagcagg 436


>KMC004491A_C01 KMC004491A_c01
          Length = 532

 Score = 42.1 bits (21), Expect = 8e-04
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 421 cgctttactgaacagggggatgctttaacatttgaatcaga 461
           ||||| || ||||| || |||||||| ||||||||||||||
Sbjct: 530 cgcttcacagaacaaggagatgctttgacatttgaatcaga 490


  Database: lotus_consensus
    Posted date:  Nov 10, 2006  2:59 PM
  Number of letters in database: 5,164,774
  Number of sequences in database:  8469
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3030
Number of Sequences: 8469
Number of extensions: 3030
Number of successful extensions: 862
Number of sequences better than 1.0e-03: 2
Number of HSP's better than  0.0 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 858
Number of HSP's gapped (non-prelim): 4
length of query: 777
length of database: 5,164,774
effective HSP length: 16
effective length of query: 761
effective length of database: 5,029,270
effective search space: 3827274470
effective search space used: 3827274470
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)