Miyakogusa Predicted Gene

chr6.LjT34E09.90.nc
Show Alignment:  

BLASTN 2.2.13 [Nov-27-2005]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr6.LjT34E09.90.nc + phase: 0 
         (1947 letters)

Database: lotus_consensus 
           8469 sequences; 5,164,774 total letters

Searching..................................................done

                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KMC020398A_C01 KMC020398A_c01                                         131   3e-30

>KMC020398A_C01 KMC020398A_c01
          Length = 577

 Score =  131 bits (66), Expect = 3e-30
 Identities = 165/198 (83%)
 Strand = Plus / Minus

                                                                        
Query: 1520 catccccaacgcttgctgctgcttcttctctaggacttttttcagggcctggatcagcgg 1579
            |||| |||||||||||||| ||| ||||||| ||||||||||| |||   |||||||| |
Sbjct: 577  catctccaacgcttgctgccgctgcttctctgggacttttttccgggataggatcagctg 518

                                                                        
Query: 1580 cgacatcaggagcggcttctccggtagactggagcactggtgggtcaatcaagttcgatt 1639
            | || ||||| ||  |||||||||||||||||||||||||||||||  |  ||||||| |
Sbjct: 517  ccacttcaggggcatcttctccggtagactggagcactggtgggtcggtgcagttcgact 458

                                                                        
Query: 1640 atacaaacatagactggtccttagataggggttcatctcctccaaggtccaatgcattat 1699
            |||| | ||||||||||||||| ||||| |||| | || | |||||||| ||| | ||||
Sbjct: 457  ataccagcatagactggtccttggatagaggtttagcttcgccaaggtcaaatcctttat 398

                              
Query: 1700 ggcgaggactttcacctt 1717
            ||  ||| ||||||||||
Sbjct: 397  ggttagggctttcacctt 380



 Score =  121 bits (61), Expect = 3e-27
 Identities = 79/85 (92%)
 Strand = Plus / Minus

                                                                        
Query: 1862 ctggttctcgagaatggagttctccatttgaagggaaagatatttttactttacctagac 1921
            |||||||||| || ||||||||||| ||||||||||||||| |||||| |||||| ||||
Sbjct: 232  ctggttctcgggattggagttctccgtttgaagggaaagatctttttagtttaccgagac 173

                                     
Query: 1922 agtttgtttcttctccttctctgta 1946
            |||||||||||||||||||||||||
Sbjct: 172  agtttgtttcttctccttctctgta 148


  Database: lotus_consensus
    Posted date:  Nov 10, 2006  2:59 PM
  Number of letters in database: 5,164,774
  Number of sequences in database:  8469
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7217
Number of Sequences: 8469
Number of extensions: 7217
Number of successful extensions: 2091
Number of sequences better than 1.0e-03: 1
Number of HSP's better than  0.0 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 2088
Number of HSP's gapped (non-prelim): 3
length of query: 1947
length of database: 5,164,774
effective HSP length: 17
effective length of query: 1930
effective length of database: 5,020,801
effective search space: 9690145930
effective search space used: 9690145930
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 22 (44.1 bits)