Miyakogusa Predicted Gene
- chr5.CM0345.1450.nc
BLASTN 2.2.13 [Nov-27-2005]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= chr5.CM0345.1450.nc - phase: 1 /partial
(1856 letters)
Database: lotus_consensus
8469 sequences; 5,164,774 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
KMC000792A_C01 KMC000792A_c01 379 e-105
>KMC000792A_C01 KMC000792A_c01
Length = 677
Score = 379 bits (191), Expect = e-105
Identities = 197/199 (98%)
Strand = Plus / Minus
Query: 1658 tcataggtgcttctcaggcactgttgactacatatggcgatctgaaggtctgcaaaccac 1717
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 677 tcataggtgcttctcaggcactgttgactacatatggcgatctgaaggtctgcaaaccac 618
Query: 1718 cagagttcttgctccaatacctaaacatgtcatggaatggactccagggttccctacaaa 1777
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 617 cagagttcttgctccgatacctaaacatgtcatggaatggactccagggttccctaccaa 558
Query: 1778 gaaatggggtagtgatcatattgccttggtatccgagttggctttcttgaaagagggtag 1837
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 557 gaaatggggtagtgatcatattgccttggtatccgagttggctttcttgaaagagggtag 498
Query: 1838 cgacatcagcaaggatgtt 1856
|||||||||||||||||||
Sbjct: 497 cgacatcagcaaggatgtt 479
Database: lotus_consensus
Posted date: Nov 10, 2006 2:59 PM
Number of letters in database: 5,164,774
Number of sequences in database: 8469
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6169
Number of Sequences: 8469
Number of extensions: 6169
Number of successful extensions: 1655
Number of sequences better than 1.0e-03: 1
Number of HSP's better than 0.0 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 1654
Number of HSP's gapped (non-prelim): 1
length of query: 1856
length of database: 5,164,774
effective HSP length: 17
effective length of query: 1839
effective length of database: 5,020,801
effective search space: 9233253039
effective search space used: 9233253039
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 22 (44.1 bits)