Miyakogusa Predicted Gene

chr5.CM0328.630.nc

BLASTN 2.2.13 [Nov-27-2005]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr5.CM0328.630.nc + phase: 0 
         (2217 letters)

Database: lotus_consensus 
           8469 sequences; 5,164,774 total letters

Searching..................................................done

                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KMC003820A_C01 KMC003820A_c01                                          56   2e-07
KMC002777A_C01 KMC002777A_c01                                          50   9e-06

>KMC003820A_C01 KMC003820A_c01
          Length = 548

 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 373 ctcatctccgtcaccaccgacgaggacctcgagaatatgatcgatgagtacgatcg 428
           |||||||||||||||| |||||| ||||||||| |  ||||  |||||||||||||
Sbjct: 358 ctcatctccgtcaccaacgacgacgacctcgagcacttgatgcatgagtacgatcg 413


>KMC002777A_C01 KMC002777A_c01
          Length = 519

 Score = 50.1 bits (25), Expect = 9e-06
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 1330 cctgtgatctatcaagagcaagttctgattcaatctggaac 1370
            ||||| ||||||||||| |||||||  ||||||||||||||
Sbjct: 199  cctgtaatctatcaagaccaagttcaaattcaatctggaac 239


  Database: lotus_consensus
    Posted date:  Nov 10, 2006  2:59 PM
  Number of letters in database: 5,164,774
  Number of sequences in database:  8469
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7752
Number of Sequences: 8469
Number of extensions: 7752
Number of successful extensions: 2683
Number of sequences better than 1.0e-03: 2
Number of HSP's better than  0.0 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 2679
Number of HSP's gapped (non-prelim): 4
length of query: 2217
length of database: 5,164,774
effective HSP length: 17
effective length of query: 2200
effective length of database: 5,020,801
effective search space: 11045762200
effective search space used: 11045762200
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 22 (44.1 bits)