Miyakogusa Predicted Gene

chr4.LjT06B21.60.nd
Show Alignment:  

BLASTN 2.2.13 [Nov-27-2005]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr4.LjT06B21.60.nd + phase: 0 
         (1806 letters)

Database: lotus_consensus 
           8469 sequences; 5,164,774 total letters

Searching..................................................done

                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KMC000303A_C01 KMC000303A_c01                                         434   e-121

>KMC000303A_C01 KMC000303A_c01
          Length = 715

 Score =  434 bits (219), Expect = e-121
 Identities = 219/219 (100%)
 Strand = Plus / Minus

                                                                        
Query: 1588 tatgtactgtggcctgaatgtggttggcagccagtttctttgactgatttgattacagct 1647
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 715  tatgtactgtggcctgaatgtggttggcagccagtttctttgactgatttgattacagct 656

                                                                        
Query: 1648 gcttctgttaaaaaagcctataggaaagctacattgtgcattcatcctgataaagtacag 1707
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 655  gcttctgttaaaaaagcctataggaaagctacattgtgcattcatcctgataaagtacag 596

                                                                        
Query: 1708 cagaagggtgccacccttcagcagaaatatattgccgagaaggtgtttgatctactaaag 1767
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 595  cagaagggtgccacccttcagcagaaatatattgccgagaaggtgtttgatctactaaag 536

                                                   
Query: 1768 gaatcctggaataaattcaattctgaggagcttttctag 1806
            |||||||||||||||||||||||||||||||||||||||
Sbjct: 535  gaatcctggaataaattcaattctgaggagcttttctag 497


  Database: lotus_consensus
    Posted date:  Nov 10, 2006  2:59 PM
  Number of letters in database: 5,164,774
  Number of sequences in database:  8469
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6889
Number of Sequences: 8469
Number of extensions: 6889
Number of successful extensions: 1908
Number of sequences better than 1.0e-03: 1
Number of HSP's better than  0.0 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 1907
Number of HSP's gapped (non-prelim): 1
length of query: 1806
length of database: 5,164,774
effective HSP length: 17
effective length of query: 1789
effective length of database: 5,020,801
effective search space: 8982212989
effective search space used: 8982212989
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 22 (44.1 bits)