Miyakogusa Predicted Gene
- chr4.CM0333.280.nc
BLASTN 2.2.13 [Nov-27-2005]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= chr4.CM0333.280.nc + phase: 0
(1650 letters)
Database: lotus_consensus
8469 sequences; 5,164,774 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
KMC005436A_C01 KMC005436A_c01 84 5e-16
>KMC005436A_C01 KMC005436A_c01
Length = 866
Score = 83.8 bits (42), Expect = 5e-16
Identities = 123/150 (82%)
Strand = Plus / Plus
Query: 436 atcatagtttcagctgtgacttcctttaagatacataatgacaagtcaccattttctggg 495
|||||||||||||| ||||||| || || | ||||| |||| || ||||||||||
Sbjct: 706 atcatagtttcagcaatgacttctttgaaaaaacatactgactcatcggcattttctgga 765
Query: 496 aaatccatactttacttaaatcggcatcagactgaagaatggaaaggctggatgcaggtt 555
| | |||||||||| | ||||||||||| || |||||||||||||| |||||||||||
Sbjct: 766 agaagcatactttaccttaatcggcatcaaacagaagaatggaaaggatggatgcaggtc 825
Query: 556 ttgtttttgatgtaccattactttgctgca 585
| ||| | ||||||||||| |||||||||
Sbjct: 826 ctctttctaatgtaccattattttgctgca 855
Database: lotus_consensus
Posted date: Nov 10, 2006 2:59 PM
Number of letters in database: 5,164,774
Number of sequences in database: 8469
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5933
Number of Sequences: 8469
Number of extensions: 5933
Number of successful extensions: 1598
Number of sequences better than 1.0e-03: 1
Number of HSP's better than 0.0 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 1596
Number of HSP's gapped (non-prelim): 1
length of query: 1650
length of database: 5,164,774
effective HSP length: 17
effective length of query: 1633
effective length of database: 5,020,801
effective search space: 8198968033
effective search space used: 8198968033
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 22 (44.1 bits)