Miyakogusa Predicted Gene
- chr4.CM0281.230.nc
BLASTN 2.2.13 [Nov-27-2005]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= chr4.CM0281.230.nc - phase: 0
(4197 letters)
Database: lotus_consensus
8469 sequences; 5,164,774 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
KMC002744A_C01 KMC002744A_c01 242 2e-63
>KMC002744A_C01 KMC002744A_c01
Length = 532
Score = 242 bits (122), Expect = 2e-63
Identities = 143/150 (95%)
Strand = Plus / Minus
Query: 4048 ttctatcccaccacaaaaatgaatgaagctaagcctctaggggaagctttgggaatgcca 4107
|||||||||||| | | ||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 532 ttctatcccaccccccacatgaatgaagctaagcctctaggggaagctttgggtatgcca 473
Query: 4108 ccatcaacatttatgccagatgatgcttctttaatgcacactcctgtgaagagtgggagt 4167
||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 472 ccatccacatttatgccagatgatgcttctttaatgcacactcccgtgaagagtgggagt 413
Query: 4168 tttggagatcttcatgaggttgaactttga 4197
||||||||||||||||||||||||||||||
Sbjct: 412 tttggagatcttcatgaggttgaactttga 383
Database: lotus_consensus
Posted date: Nov 10, 2006 2:59 PM
Number of letters in database: 5,164,774
Number of sequences in database: 8469
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 15,232
Number of Sequences: 8469
Number of extensions: 15232
Number of successful extensions: 4235
Number of sequences better than 1.0e-03: 1
Number of HSP's better than 0.0 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 4234
Number of HSP's gapped (non-prelim): 1
length of query: 4197
length of database: 5,164,774
effective HSP length: 17
effective length of query: 4180
effective length of database: 5,020,801
effective search space: 20986948180
effective search space used: 20986948180
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 23 (46.1 bits)