Miyakogusa Predicted Gene

chr4.CM0003.50.nd
Show Alignment: 

BLASTN 2.2.13 [Nov-27-2005]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr4.CM0003.50.nd + phase: 2 /pseudo/partial
         (1440 letters)

Database: lotus_consensus 
           8469 sequences; 5,164,774 total letters

Searching..................................................done

                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KMC000255A_C01 KMC000255A_c01                                         281   9e-76

>KMC000255A_C01 KMC000255A_c01
          Length = 621

 Score =  281 bits (142), Expect = 9e-76
 Identities = 154/158 (97%)
 Strand = Plus / Minus

                                                                        
Query: 1074 tgctggatagtccattgcataactattttaagcagcgggactgcttaaattacttctttt 1133
            ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 621  tgctggatagtccattgcataactattttaagcagcgtgactgcttaaattacttctttt 562

                                                                        
Query: 1134 gtttccgctgggttttgattcaatttaaaagggagtttgagtacgaggacacaatgcgct 1193
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 561  gtttccgctgggttttgattcaatttaaaagggagtttgagtacgaggacacaatgcgct 502

                                                  
Query: 1194 tatgggaaatattattggcgcactatccgtccgagcat 1231
            |||||||| |||||| | ||||||||||||||||||||
Sbjct: 501  tatgggaagtattatggacgcactatccgtccgagcat 464


  Database: lotus_consensus
    Posted date:  Nov 10, 2006  2:59 PM
  Number of letters in database: 5,164,774
  Number of sequences in database:  8469
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5000
Number of Sequences: 8469
Number of extensions: 5000
Number of successful extensions: 1324
Number of sequences better than 1.0e-03: 1
Number of HSP's better than  0.0 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 1323
Number of HSP's gapped (non-prelim): 1
length of query: 1440
length of database: 5,164,774
effective HSP length: 17
effective length of query: 1423
effective length of database: 5,020,801
effective search space: 7144599823
effective search space used: 7144599823
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 22 (44.1 bits)