Miyakogusa Predicted Gene

chr3.CM0279.130.nd
Show Alignment:  

BLASTN 2.2.13 [Nov-27-2005]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr3.CM0279.130.nd + phase: 0 /pseudo/partial
         (2798 letters)

Database: lotus_consensus 
           8469 sequences; 5,164,774 total letters

Searching..................................................done

                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KMC009856A_C01 KMC009856A_c01                                         141   4e-33
KMC001380A_C01 KMC001380A_c01                                          46   2e-04

>KMC009856A_C01 KMC009856A_c01
          Length = 521

 Score =  141 bits (71), Expect = 4e-33
 Identities = 71/71 (100%)
 Strand = Plus / Minus

                                                                        
Query: 2728 agggtgaacggttgacttcgagccagaaattactagcacgcaactcgtatgtaagaagcc 2787
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 284  agggtgaacggttgacttcgagccagaaattactagcacgcaactcgtatgtaagaagcc 225

                       
Query: 2788 gtggaaaacgc 2798
            |||||||||||
Sbjct: 224  gtggaaaacgc 214


>KMC001380A_C01 KMC001380A_c01
          Length = 670

 Score = 46.1 bits (23), Expect = 2e-04
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                   
Query: 2622 gcactttgtggctggcagctgactttggatgctctggat 2660
            |||||||| || |||||| |||||||||||||| |||||
Sbjct: 641  gcactttgcgggtggcagatgactttggatgctttggat 603


  Database: lotus_consensus
    Posted date:  Nov 10, 2006  2:59 PM
  Number of letters in database: 5,164,774
  Number of sequences in database:  8469
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 9686
Number of Sequences: 8469
Number of extensions: 9686
Number of successful extensions: 2666
Number of sequences better than 1.0e-03: 2
Number of HSP's better than  0.0 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 2662
Number of HSP's gapped (non-prelim): 4
length of query: 2798
length of database: 5,164,774
effective HSP length: 17
effective length of query: 2781
effective length of database: 5,020,801
effective search space: 13962847581
effective search space used: 13962847581
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 22 (44.1 bits)