Miyakogusa Predicted Gene

chr2.LjT47G24.250.nd

BLASTN 2.2.13 [Nov-27-2005]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr2.LjT47G24.250.nd - phase: 0 
         (456 letters)

Database: lotus_consensus 
           8469 sequences; 5,164,774 total letters

Searching..................................................done

                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KMC003256A_C01 KMC003256A_c01                                          60   2e-09

>KMC003256A_C01 KMC003256A_c01
          Length = 474

 Score = 60.0 bits (30), Expect = 2e-09
 Identities = 111/138 (80%)
 Strand = Plus / Minus

                                                                       
Query: 244 gaggttcaggaaaagttgtccctgttggagtggtttgcaaatgaatacagacggtttggt 303
           ||||||||||| ||| || || || | ||||||||||| ||||| ||||  || ||||| 
Sbjct: 441 gaggttcaggagaagctgcccttgcttgagtggtttgccaatgagtacaagcgatttgga 382

                                                                       
Query: 304 tgcactcttgagtttgtcaccaataagtcacaagaaggctcacagttttgcagaggtttt 363
           ||| |||| || ||||| ||||| || || ||||| || ||||| |||||||| || |||
Sbjct: 381 tgctctctggaatttgtgaccaacaaatctcaagaggggtcacaattttgcagggggttt 322

                             
Query: 364 ggtgggatagggggtatc 381
           ||||| || || ||||||
Sbjct: 321 ggtggcattggtggtatc 304


  Database: lotus_consensus
    Posted date:  Nov 10, 2006  2:59 PM
  Number of letters in database: 5,164,774
  Number of sequences in database:  8469
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1654
Number of Sequences: 8469
Number of extensions: 1654
Number of successful extensions: 454
Number of sequences better than 1.0e-03: 1
Number of HSP's better than  0.0 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 453
Number of HSP's gapped (non-prelim): 1
length of query: 456
length of database: 5,164,774
effective HSP length: 16
effective length of query: 440
effective length of database: 5,029,270
effective search space: 2212878800
effective search space used: 2212878800
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)