Miyakogusa Predicted Gene

chr1.CM0150.650.nd
Show Alignment:  

BLASTN 2.2.13 [Nov-27-2005]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= chr1.CM0150.650.nd - phase: 0 
         (1410 letters)

Database: lotus_consensus 
           8469 sequences; 5,164,774 total letters

Searching..................................................done

                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

KMC002138A_C01 KMC002138A_c01                                         444   e-124

>KMC002138A_C01 KMC002138A_c01
          Length = 517

 Score =  444 bits (224), Expect = e-124
 Identities = 234/236 (99%), Gaps = 1/236 (0%)
 Strand = Plus / Minus

                                                                        
Query: 1176 tcagggttccgccccaacaatttctgtggataacacatctggctgccagctttacctgag 1235
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 517  tcagggttccgccccaacaatttctgtggataacacatctggctgccagctttacctgag 458

                                                                        
Query: 1236 caaagattcattagaaacatccatatctacagccaagtcaagtgagatcaatgtgttggt 1295
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 457  caaagattcattagaaacatccatatctacagccaagtcaagtgagatcaatgtgttggt 398

                                                                        
Query: 1296 acctggtgctgagcctgatggtgatttggtggagcattctttgccacaacaatacattca 1355
            |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 397  acctggtgctgagcctgatggtgatttggtggagcattctttgccacaaccatacattca 338

                                                                    
Query: 1356 tgcctt-caaggatggtcgttttgaaacaactccagcttctcactctggaggttaa 1410
            |||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 337  tgccttgcaaggatggtcgttttgaaacaactccagcttctcactctggaggttaa 282


  Database: lotus_consensus
    Posted date:  Nov 10, 2006  2:59 PM
  Number of letters in database: 5,164,774
  Number of sequences in database:  8469
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5032
Number of Sequences: 8469
Number of extensions: 5032
Number of successful extensions: 1397
Number of sequences better than 1.0e-03: 1
Number of HSP's better than  0.0 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 1395
Number of HSP's gapped (non-prelim): 1
length of query: 1410
length of database: 5,164,774
effective HSP length: 17
effective length of query: 1393
effective length of database: 5,020,801
effective search space: 6993975793
effective search space used: 6993975793
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 22 (44.1 bits)