Miyakogusa Predicted Gene

Lj6g3v2043280.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v2043280.1 Non Chatacterized Hit- tr|D7SIK8|D7SIK8_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,48.86,8e-17,CCCH zinc finger,NULL; zf-CCCH,Zinc finger, CCCH-type;
zinc finger,Zinc finger, CCCH-type; seg,NULL;,CUFF.60638.1
         (1764 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC79304                                                      254   2e-66

>gnl|LJGI|TC79304 
          Length = 495

 Score =  254 bits (128), Expect = 2e-66
 Identities = 143/148 (96%)
 Strand = Plus / Plus

                                                                        
Query: 1617 aaaatcagttgacaaggtcattagcaccttggagcctcaccagattccgacctctgtaga 1676
            |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||
Sbjct: 1    aaaatcagttgacaaggtcattagtaccttggagcctcaccagattccgacctccgtaga 60

                                                                        
Query: 1677 tactgctaagcactatgtgacttcatgtcgggggaaaattgcaaagctggtcacgggata 1736
            |||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 61   tactgctaagaactatgtgacttcatgtcgggggaaaattgcaaagctggtcatgggata 120

                                        
Query: 1737 tgtcactaaatatggcaaatcttgatat 1764
            ||||||||||||||||||||| ||||||
Sbjct: 121  tgtcactaaatatggcaaatcatgatat 148