Miyakogusa Predicted Gene
- Lj6g3v0727750.2
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj6g3v0727750.2 Non Chatacterized Hit- tr|I1N087|I1N087_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.19659 PE,85.45,0,no
description,NULL; RCMTFAMILY,RNA (C5-cytosine) methyltransferase;
seg,NULL; Nol1_Nop2_Fmu,Bacteri,CUFF.58216.2
(828 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC66916 188 4e-47
>gnl|LJGI|TC66916
Length = 621
Score = 188 bits (95), Expect = 4e-47
Identities = 95/95 (100%)
Strand = Plus / Plus
Query: 734 aaatagatacagaggttgtggaggaagaggacaaaccaagtaatggcgtaaaagaaaatg 793
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 aaatagatacagaggttgtggaggaagaggacaaaccaagtaatggcgtaaaagaaaatg 60
Query: 794 gcaaacaaacttctgaatctgaattgaaaacgaag 828
|||||||||||||||||||||||||||||||||||
Sbjct: 61 gcaaacaaacttctgaatctgaattgaaaacgaag 95