Miyakogusa Predicted Gene
- Lj6g3v0607190.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj6g3v0607190.1 Non Chatacterized Hit- tr|I1N015|I1N015_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,77.85,0,myb_SHAQKYF:
myb-like DNA-binding domain, SHAQKYF ,Myb domain, plants; seg,NULL;
SUBFAMILY NOT NAMED,CUFF.58079.1
(897 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|GO010963 similar to UniRef100_Q0PJL5 Cluster: MYB trans... 1035 0.0
gnl|LJGI|TC80644 similar to UniRef100_Q66RN1 Cluster: MYB transc... 194 7e-49
gnl|LJGI|GO012661 similar to UniRef100_Q0PJJ2 Cluster: MYB trans... 101 7e-21
gnl|LJGI|TC71658 similar to UniRef100_Q0PJK8 Cluster: MYB transc... 76 4e-13
gnl|LJGI|GO024789 similar to UniRef100_Q0PJI8 Cluster: MYB trans... 60 2e-08
gnl|LJGI|TC73393 similar to UniRef100_Q2LMD7 Cluster: MYBR2; n=1... 60 2e-08
gnl|LJGI|TC71568 homologue to UniRef100_Q8S8Z9 Cluster: Syringol... 60 2e-08
gnl|LJGI|TC76188 similar to UniRef100_Q0PJI8 Cluster: MYB transc... 58 1e-07
gnl|LJGI|TC69475 similar to UniRef100_A7QNL8 Cluster: Chromosome... 58 1e-07
>gnl|LJGI|GO010963 similar to UniRef100_Q0PJL5 Cluster: MYB transcription factor
MYB57; n=1; Glycine max|Rep: MYB transcription factor
MYB57 - Glycine max (Soybean), partial (46%)
Length = 569
Score = 1035 bits (522), Expect = 0.0
Identities = 522/522 (100%)
Strand = Plus / Plus
Query: 1 atgaagtgggaaatggaaatccttcctccagcaccatatattcacaaccccaacaatagc 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 48 atgaagtgggaaatggaaatccttcctccagcaccatatattcacaaccccaacaatagc 107
Query: 61 accaattggcttctagaagataataggaacaccaaatggacccctgcagagaacaagctg 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 108 accaattggcttctagaagataataggaacaccaaatggacccctgcagagaacaagctg 167
Query: 121 tttgaaaatgctcttgcagtgtatgataaggacaccccggatcggtggtacagggtggct 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 168 tttgaaaatgctcttgcagtgtatgataaggacaccccggatcggtggtacagggtggct 227
Query: 181 gagatgataccaggaaaaacagttgtggatgtgataaagcagtacaaggaattggaagtg 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 228 gagatgataccaggaaaaacagttgtggatgtgataaagcagtacaaggaattggaagtg 287
Query: 241 gatgtttgtaacatagaagctgggttggtcccaattcctggctacagcagcactacctca 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 288 gatgtttgtaacatagaagctgggttggtcccaattcctggctacagcagcactacctca 347
Query: 301 cccttcaccttagactgggtgaacacccctcctgggtatgatgggtttaaaggactcact 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 348 cccttcaccttagactgggtgaacacccctcctgggtatgatgggtttaaaggactcact 407
Query: 361 gcaaagagatcctcttcaggcagattacctgatcaggaaaggaagaaaggtgtgccatgg 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 408 gcaaagagatcctcttcaggcagattacctgatcaggaaaggaagaaaggtgtgccatgg 467
Query: 421 actgaagaggaacacaagttgtttctgctgggtctgaaaaagtatggcaaaggagattgg 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 468 actgaagaggaacacaagttgtttctgctgggtctgaaaaagtatggcaaaggagattgg 527
Query: 481 aggaacatttcaaggaattttgtgattactagaacaccaact 522
||||||||||||||||||||||||||||||||||||||||||
Sbjct: 528 aggaacatttcaaggaattttgtgattactagaacaccaact 569
>gnl|LJGI|TC80644 similar to UniRef100_Q66RN1 Cluster: MYB transcription factor; n=1;
Hevea brasiliensis|Rep: MYB transcription factor - Hevea
brasiliensis (Para rubber tree), partial (79%)
Length = 1931
Score = 194 bits (98), Expect = 7e-49
Identities = 185/214 (86%)
Strand = Plus / Plus
Query: 389 ctgatcaggaaaggaagaaaggtgtgccatggactgaagaggaacacaagttgtttctgc 448
|||| ||||||||||| ||||| ||||||||||||||||||||||||| | | |||||||
Sbjct: 1113 ctgaacaggaaaggaaaaaaggagtgccatggactgaagaggaacacaggctatttctgc 1172
Query: 449 tgggtctgaaaaagtatggcaaaggagattggaggaacatttcaaggaattttgtgatta 508
|||||||||| |||||||| ||||| |||||||| ||||| || ||||||||||||| |
Sbjct: 1173 tgggtctgaagaagtatggtaaaggggattggagaaacatctctaggaattttgtgacca 1232
Query: 509 ctagaacaccaactcaggtggctagccatgctcagaagtacttcatcaggcaactttcag 568
| |||||||| |||||||| || || |||||||||||||| ||||||||||| ||| |||
Sbjct: 1233 caagaacacccactcaggttgcgagtcatgctcagaagtatttcatcaggcagcttacag 1292
Query: 569 ggggaaaagacaagaggagagctagcatccatga 602
| ||||| || ||||| ||| | || ||||||||
Sbjct: 1293 gaggaaaggataagagaagatccagtatccatga 1326
Score = 83.8 bits (42), Expect = 2e-15
Identities = 141/174 (81%)
Strand = Plus / Plus
Query: 108 agagaacaagctgtttgaaaatgctcttgcagtgtatgataaggacaccccggatcggtg 167
|||||||||||||||||| |||||| | || | |||||||||||||||||||| ||
Sbjct: 817 agagaacaagctgtttgagaatgctttggcttatttcgataaggacaccccggatcgatg 876
Query: 168 gtacagggtggctgagatgataccaggaaaaacagttgtggatgtgataaagcagtacaa 227
|| |||||||| |||||| ||||| ||||| || | |||||||| || ||||||||
Sbjct: 877 gttgagggtggcatcgatgattccagggaaaactgtgggtgatgtgatcaaacagtacaa 936
Query: 228 ggaattggaagtggatgtttgtaacatagaagctgggttggtcccaattcctgg 281
|||| | |||| |||||| ||| ||| ||||| || ||||||||| |||||||
Sbjct: 937 ggaacttgaagaggatgtgtgtgtcattgaagcaggtttggtcccagttcctgg 990
>gnl|LJGI|GO012661 similar to UniRef100_Q0PJJ2 Cluster: MYB transcription factor
MYB109; n=1; Glycine max|Rep: MYB transcription factor
MYB109 - Glycine max (Soybean), partial (63%)
Length = 702
Score = 101 bits (51), Expect = 7e-21
Identities = 84/95 (88%)
Strand = Plus / Plus
Query: 460 aagtatggcaaaggagattggaggaacatttcaaggaattttgtgattactagaacacca 519
|||| ||| ||||| |||||||| | |||||||||||| ||||||||| |||| ||||||
Sbjct: 537 aagtttgggaaaggggattggagaagcatttcaaggaactttgtgatttctaggacacca 596
Query: 520 actcaggtggctagccatgctcagaagtacttcat 554
||||| ||||| |||||||| ||||||||||||||
Sbjct: 597 actcaagtggcaagccatgcacagaagtacttcat 631
>gnl|LJGI|TC71658 similar to UniRef100_Q0PJK8 Cluster: MYB transcription factor
MYB75; n=1; Glycine max|Rep: MYB transcription factor
MYB75 - Glycine max (Soybean), partial (80%)
Length = 1397
Score = 75.8 bits (38), Expect = 4e-13
Identities = 88/104 (84%), Gaps = 3/104 (2%)
Strand = Plus / Plus
Query: 529 gctagccatgctcagaagtacttcatcaggcaac---tttcagggggaaaagacaagagg 585
|||||||||||||||||||||| ||| |||||| |||| || || ||||| ||||||
Sbjct: 872 gctagccatgctcagaagtactacataaggcaaaaggtttctggaggtaaagataagagg 931
Query: 586 agagctagcatccatgacataacaacagttaatctcacagaaac 629
||| | ||||||||||| ||||| || |||||||| ||||||||
Sbjct: 932 agaccaagcatccatgatataaccactgttaatcttacagaaac 975
>gnl|LJGI|GO024789 similar to UniRef100_Q0PJI8 Cluster: MYB transcription factor
MYB127; n=1; Glycine max|Rep: MYB transcription factor
MYB127 - Glycine max (Soybean), partial (62%)
Length = 718
Score = 60.0 bits (30), Expect = 2e-08
Identities = 48/54 (88%)
Strand = Plus / Plus
Query: 501 tgtgattactagaacaccaactcaggtggctagccatgctcagaagtacttcat 554
||||| ||| ||||||||||| || || || |||||||||||||||||||||||
Sbjct: 477 tgtgactacaagaacaccaacccaagttgcaagccatgctcagaagtacttcat 530
>gnl|LJGI|TC73393 similar to UniRef100_Q2LMD7 Cluster: MYBR2; n=1; Malus x
domestica|Rep: MYBR2 - Malus domestica (Apple) (Malus
sylvestris), partial (34%)
Length = 504
Score = 60.0 bits (30), Expect = 2e-08
Identities = 36/38 (94%)
Strand = Plus / Plus
Query: 397 gaaaggaagaaaggtgtgccatggactgaagaggaaca 434
||||||||||||||||| |||||||||||||| |||||
Sbjct: 392 gaaaggaagaaaggtgttccatggactgaagaagaaca 429
>gnl|LJGI|TC71568 homologue to UniRef100_Q8S8Z9 Cluster: Syringolide-induced protein
1-3-1B; n=1; Glycine max|Rep: Syringolide-induced
protein 1-3-1B - Glycine max (Soybean), partial (54%)
Length = 538
Score = 60.0 bits (30), Expect = 2e-08
Identities = 72/86 (83%)
Strand = Plus / Plus
Query: 418 tggactgaagaggaacacaagttgtttctgctgggtctgaaaaagtatggcaaaggagat 477
||||||||||||||||||| | |||| || | || || | |||| |||||||||||||
Sbjct: 453 tggactgaagaggaacacaggctgttccttgttgggctaagcaagtttggcaaaggagat 512
Query: 478 tggaggaacatttcaaggaattttgt 503
||||| | ||||||||||||| ||||
Sbjct: 513 tggagaagcatttcaaggaatgttgt 538
>gnl|LJGI|TC76188 similar to UniRef100_Q0PJI8 Cluster: MYB transcription factor
MYB127; n=1; Glycine max|Rep: MYB transcription factor
MYB127 - Glycine max (Soybean), partial (61%)
Length = 1042
Score = 58.0 bits (29), Expect = 1e-07
Identities = 47/53 (88%)
Strand = Plus / Plus
Query: 499 tttgtgattactagaacaccaactcaggtggctagccatgctcagaagtactt 551
||||||| ||| ||||| ||||| || ||||| ||||||||||||||||||||
Sbjct: 463 tttgtgactacaagaaccccaacacaagtggccagccatgctcagaagtactt 515
>gnl|LJGI|TC69475 similar to UniRef100_A7QNL8 Cluster: Chromosome undetermined
scaffold_133, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome undetermined scaffold_133,
whole genome shotgun sequence - Vitis vinifera (Grape),
partial (79%)
Length = 1444
Score = 58.0 bits (29), Expect = 1e-07
Identities = 110/137 (80%)
Strand = Plus / Plus
Query: 418 tggactgaagaggaacacaagttgtttctgctgggtctgaaaaagtatggcaaaggagat 477
|||||||| || ||||||| |||||||| || ||| || | |||||||| ||||| ||
Sbjct: 692 tggactgaggaagaacacagattgtttcttcttggtttggataagtatggaaaaggtgac 751
Query: 478 tggaggaacatttcaaggaattttgtgattactagaacaccaactcaggtggctagccat 537
||| | | || |||||||| |||||| | || ||||||||||| || || || ||||||
Sbjct: 752 tggcgaagtatatcaaggaactttgtggtgacaagaacaccaacacaagtagcaagccat 811
Query: 538 gctcagaagtacttcat 554
|| || |||||||||||
Sbjct: 812 gcccaaaagtacttcat 828