Miyakogusa Predicted Gene

Lj5g3v1015080.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v1015080.1 Non Chatacterized Hit- tr|I1L889|I1L889_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.48417
PE,83.98,0,Interferon-induced guanylate-binding protein 1 (GBP1),
C-terminal domain,Guanylate-binding protein, ,CUFF.54652.1
         (1092 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC75786 weakly similar to UniRef100_A7PUJ8 Cluster: Chr...   105   6e-22

>gnl|LJGI|TC75786 weakly similar to UniRef100_A7PUJ8 Cluster: Chromosome chr7
            scaffold_31, whole genome shotgun sequence; n=1; Vitis
            vinifera|Rep: Chromosome chr7 scaffold_31, whole genome
            shotgun sequence - Vitis vinifera (Grape), partial (9%)
          Length = 533

 Score =  105 bits (53), Expect = 6e-22
 Identities = 94/108 (87%)
 Strand = Plus / Plus

                                                                        
Query: 918  tgtttacagcccaatccttgatcttgacagatgggcaattccccttggtgtaatactgtc 977
            |||||||||||| ||||| ||||||||||||||| | |||||||||||||||||| | ||
Sbjct: 1    tgtttacagcccnatcctggatcttgacagatggtctattccccttggtgtaatagtttc 60

                                                            
Query: 978  attgctcttcctttattggcggtgttatgggaaaatgaactatggatc 1025
            |||  || | |||||||||||||||| |||||||| |||  |||||||
Sbjct: 61   atttttcatactttattggcggtgttgtgggaaaaggaaacatggatc 108