Miyakogusa Predicted Gene

Lj4g3v2825540.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2825540.1 Non Chatacterized Hit- tr|I1K512|I1K512_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.42691
PE,63.64,0.0000000000006,seg,NULL,95247_g.1
         (205 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC78635 similar to UniRef100_A7QST8 Cluster: Chromosome...    56   8e-08

>gnl|LJGI|TC78635 similar to UniRef100_A7QST8 Cluster: Chromosome chr4 scaffold_162,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr4 scaffold_162, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (76%)
          Length = 1554

 Score = 56.0 bits (28), Expect = 8e-08
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                       
Query: 178 atagctgacaatttcagctcattggatc 205
           ||||||||||||||||||||||||||||
Sbjct: 298 atagctgacaatttcagctcattggatc 325