Miyakogusa Predicted Gene
- Lj4g3v2775620.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v2775620.1 tr|G1MDL8|G1MDL8_AILME Ubiquitin
carboxyl-terminal hydrolase OS=Ailuropoda melanoleuca GN=USP30
PE=3,25.98,1e-17,UCH_2_2,Peptidase C19, ubiquitin carboxyl-terminal
hydrolase 2, conserved site; UCH,Peptidase C19, u,CUFF.51620.1
(1722 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|AV777197 similar to UniRef100_A7PKY6 Cluster: Ubiquitin... 194 1e-48
gnl|LJGI|AV411271 similar to UniRef100_A6M316 Cluster: PpiC-type... 163 5e-39
>gnl|LJGI|AV777197 similar to UniRef100_A7PKY6 Cluster: Ubiquitin carboxyl-terminal
hydrolase; n=1; Vitis vinifera|Rep: Ubiquitin
carboxyl-terminal hydrolase - Vitis vinifera (Grape),
partial (5%)
Length = 429
Score = 194 bits (98), Expect = 1e-48
Identities = 98/98 (100%)
Strand = Plus / Minus
Query: 1625 cagactctcaagtggatgctgtttcagaggaagatgttctatctagtgaggcaagcttgc 1684
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 429 cagactctcaagtggatgctgtttcagaggaagatgttctatctagtgaggcaagcttgc 370
Query: 1685 ttttctatgagagaattccaaagaactgtatttgagca 1722
||||||||||||||||||||||||||||||||||||||
Sbjct: 369 ttttctatgagagaattccaaagaactgtatttgagca 332
>gnl|LJGI|AV411271 similar to UniRef100_A6M316 Cluster: PpiC-type peptidyl-prolyl
cis-trans isomerase; n=1; Clostridium beijerinckii NCIMB
8052|Rep: PpiC-type peptidyl-prolyl cis-trans isomerase
- Clostridium beijerinckii NCIMB 8052, partial (5%)
Length = 430
Score = 163 bits (82), Expect = 5e-39
Identities = 135/152 (88%), Gaps = 3/152 (1%)
Strand = Plus / Plus
Query: 90 cgcactcaaggaaaccaaagcgaaaaccttgctatggtcatctggaac---aagaagaag 146
|||| |||||||| |||||| ||| | ||||||||||| |||||||| |||| | ||
Sbjct: 52 cgcattcaaggaaggcaaagcaaaatcattgctatggtcctctggaactgcaagaggtag 111
Query: 147 taatagcagcaacttggataataagaaaccgctcctagtccctggtttacacaatctccg 206
||||||||||||||| || ||| ||||||||||| ||||||||||||| |||||||||||
Sbjct: 112 taatagcagcaacttagagaatgagaaaccgctcttagtccctggtttgcacaatctccg 171
Query: 207 caacaattgcttcctcaacgttgttttgcagg 238
||||||||||||||||||||||||||||||||
Sbjct: 172 caacaattgcttcctcaacgttgttttgcagg 203