Miyakogusa Predicted Gene

Lj4g3v1535050.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v1535050.1 CUFF.49403.1
         (316 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC80490 similar to UniRef100_Q0YRG1 Cluster: Abortive i...   107   4e-23
gnl|LJGI|TC78189 similar to UniRef100_Q6R567 Cluster: Ring domai...    54   5e-07
gnl|LJGI|TC73945 similar to UniRef100_Q461Q8 Cluster: NADH dehyd...    54   5e-07

>gnl|LJGI|TC80490 similar to UniRef100_Q0YRG1 Cluster: Abortive infection protein;
          n=1; Chlorobium ferrooxidans DSM 13031|Rep: Abortive
          infection protein - Chlorobium ferrooxidans DSM 13031,
          partial (7%)
          Length = 536

 Score =  107 bits (54), Expect = 4e-23
 Identities = 54/54 (100%)
 Strand = Plus / Minus

                                                                
Query: 1  atgtgtttctgtgtcattgtggaagagggaacttgcagcaaagattgtggggat 54
          ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 63 atgtgtttctgtgtcattgtggaagagggaacttgcagcaaagattgtggggat 10


>gnl|LJGI|TC78189 similar to UniRef100_Q6R567 Cluster: Ring domain containing
           protein; n=1; Capsicum annuum|Rep: Ring domain
           containing protein - Capsicum annuum (Bell pepper),
           partial (58%)
          Length = 1040

 Score = 54.0 bits (27), Expect = 5e-07
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 209 aagtcagaataagagaagacacaaaactacgcaacaaag 247
           |||||||||||||||||||||||  ||| ||||||||||
Sbjct: 912 aagtcagaataagagaagacacattactgcgcaacaaag 874


>gnl|LJGI|TC73945 similar to UniRef100_Q461Q8 Cluster: NADH dehydrogenase subunit 4L;
           n=1; Drosophila willistoni|Rep: NADH dehydrogenase
           subunit 4L - Drosophila willistoni (Fruit fly), partial
           (20%)
          Length = 1035

 Score = 54.0 bits (27), Expect = 5e-07
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 62  tctcttgcttattaaacttaaaagacacaatttat 96
           |||||| |||||||||||||| |||||||||||||
Sbjct: 440 tctctttcttattaaacttaagagacacaatttat 406