Miyakogusa Predicted Gene

Lj4g3v1152920.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v1152920.1 Non Chatacterized Hit- tr|I1J9K5|I1J9K5_SOYBN
Uncharacterized protein OS=Glycine max PE=3 SV=1,81.82,0,no
description,Cytochrome P450; no description,NULL; SUBFAMILY NOT
NAMED,NULL; FAMILY NOT NAMED,NULL,gene.g54123.t1.1
         (1608 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC59174 similar to UniRef100_P16048 Cluster: Glycine cl...   517   e-146
gnl|LJGI|TC78178 homologue to UniRef100_P16048 Cluster: Glycine ...   482   e-135
gnl|LJGI|AV779394 similar to UniRef100_P46485 Cluster: Glycine c...   256   4e-67

>gnl|LJGI|TC59174 similar to UniRef100_P16048 Cluster: Glycine cleavage system H
            protein, mitochondrial precursor; n=9; Pisum|Rep: Glycine
            cleavage system H protein, mitochondrial precursor -
            Pisum sativum (Garden pea), complete
          Length = 791

 Score =  517 bits (261), Expect = e-146
 Identities = 261/261 (100%)
 Strand = Plus / Plus

                                                                        
Query: 1315 gtcttggatggactcaagtacgcttcttcacatgaatgggtcaagcatgaaggctctgta 1374
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 190  gtcttggatggactcaagtacgcttcttcacatgaatgggtcaagcatgaaggctctgta 249

                                                                        
Query: 1375 gctaccattggtatcactgatcatgcccaggaccatcttggagaggttgtgtttgtggag 1434
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 250  gctaccattggtatcactgatcatgcccaggaccatcttggagaggttgtgtttgtggag 309

                                                                        
Query: 1435 ctgccagaatccggtaagccagttactaaaggtgacggttttggagcagttgagagtgtt 1494
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 310  ctgccagaatccggtaagccagttactaaaggtgacggttttggagcagttgagagtgtt 369

                                                                        
Query: 1495 aaagctacaagtgatatcaactctccaatctcaggggagattattgaggttaacactaag 1554
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 370  aaagctacaagtgatatcaactctccaatctcaggggagattattgaggttaacactaag 429

                                 
Query: 1555 ctctccgaacaacctggcctg 1575
            |||||||||||||||||||||
Sbjct: 430  ctctccgaacaacctggcctg 450


>gnl|LJGI|TC78178 homologue to UniRef100_P16048 Cluster: Glycine cleavage system H
            protein, mitochondrial precursor; n=9; Pisum|Rep: Glycine
            cleavage system H protein, mitochondrial precursor -
            Pisum sativum (Garden pea), partial (71%)
          Length = 480

 Score =  482 bits (243), Expect = e-135
 Identities = 243/243 (100%)
 Strand = Plus / Plus

                                                                        
Query: 1315 gtcttggatggactcaagtacgcttcttcacatgaatgggtcaagcatgaaggctctgta 1374
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 238  gtcttggatggactcaagtacgcttcttcacatgaatgggtcaagcatgaaggctctgta 297

                                                                        
Query: 1375 gctaccattggtatcactgatcatgcccaggaccatcttggagaggttgtgtttgtggag 1434
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 298  gctaccattggtatcactgatcatgcccaggaccatcttggagaggttgtgtttgtggag 357

                                                                        
Query: 1435 ctgccagaatccggtaagccagttactaaaggtgacggttttggagcagttgagagtgtt 1494
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 358  ctgccagaatccggtaagccagttactaaaggtgacggttttggagcagttgagagtgtt 417

                                                                        
Query: 1495 aaagctacaagtgatatcaactctccaatctcaggggagattattgaggttaacactaag 1554
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 418  aaagctacaagtgatatcaactctccaatctcaggggagattattgaggttaacactaag 477

               
Query: 1555 ctc 1557
            |||
Sbjct: 478  ctc 480


>gnl|LJGI|AV779394 similar to UniRef100_P46485 Cluster: Glycine cleavage system H
            protein, mitochondrial precursor; n=2; Flaveria|Rep:
            Glycine cleavage system H protein, mitochondrial
            precursor - Flaveria trinervia (Clustered yellowtops)
            (Oedera trinervia), partial (52%)
          Length = 457

 Score =  256 bits (129), Expect = 4e-67
 Identities = 192/209 (91%), Gaps = 3/209 (1%)
 Strand = Plus / Minus

                                                                        
Query: 1356 caagcatgaaggctctgtagctaccattggtatcactgatcatgcccaggaccatcttgg 1415
            ||||| ||||||||| |||||||||||||||||| |||||||||||| ||||||||||||
Sbjct: 457  caagcctgaaggctcggtagctaccattggtatcgctgatcatgccccggaccatcttgg 398

                                                                        
Query: 1416 agaggttgtgtttgtggagctgccagaatccggtaagccagttactaaaggtgacggttt 1475
            |||||||||||||||||||||||| |||||||||||||| |||||| |||||||||||||
Sbjct: 397  agaggttgtgtttgtggagctgcccgaatccggtaagcccgttacttaaggtgacggttt 338

                                                                        
Query: 1476 tggagcagttgagagtgtta-aagctaca-agtgatatcaactctccaatctcaggggag 1533
            |||||| | ||||||||||| |||||||| ||||||||| ||||||| ||||| ||||||
Sbjct: 337  tggagccggtgagagtgttagaagctacacagtgatatcgactctcccatctccggggag 278

                                         
Query: 1534 attattgaggttaaca-ctaagctctccg 1561
            | |||||||||| ||| ||||||||||||
Sbjct: 277  agtattgaggttgacagctaagctctccg 249