Miyakogusa Predicted Gene

Lj3g3v0663840.3
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj3g3v0663840.3 tr|B9N7G4|B9N7G4_POPTR Predicted protein
(Fragment) OS=Populus trichocarpa GN=POPTRDRAFT_273528
PE=4,48.11,3e-18,seg,NULL; COP1-INTERACTING
PROTEIN-RELATED,NULL,CUFF.42786.3
         (1230 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|DC600117 homologue to UniRef100_A2Q4Q1 Cluster: CIP7 , ...    72   9e-12

>gnl|LJGI|DC600117 homologue to UniRef100_A2Q4Q1 Cluster: CIP7 , related; n=1;
           Medicago truncatula|Rep: CIP7 , related - Medicago
           truncatula (Barrel medic), partial (7%)
          Length = 328

 Score = 71.9 bits (36), Expect = 9e-12
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 18  tcttgatcatgccctttttcaactcaccccaaccagaaccagatgtga 65
           ||||||| ||||||| ||||||||||||||||| ||||||||||||||
Sbjct: 165 tcttgattatgccctgtttcaactcaccccaactagaaccagatgtga 212