Miyakogusa Predicted Gene

Lj2g3v3340800.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v3340800.1 Non Chatacterized Hit- tr|I1LXL6|I1LXL6_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.25280
PE,62.04,2e-17,seg,NULL; VQ,VQ,CUFF.40119.1
         (624 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC68407                                                       70   2e-11

>gnl|LJGI|TC68407 
          Length = 1309

 Score = 69.9 bits (35), Expect = 2e-11
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 241 ctcaacacagacaccacaaacttccgtgccatggtgcaacagttcactggaggtccagcc 300
           |||||||||||||| || |||||||| ||||||||||| || |||||||| || ||| ||
Sbjct: 301 ctcaacacagacactaccaacttccgggccatggtgcagcaattcactggcggcccaacc 360

                      
Query: 301 gcaccctttgc 311
           ||||| |||||
Sbjct: 361 gcaccttttgc 371