Miyakogusa Predicted Gene
- Lj2g3v2411340.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj2g3v2411340.1 Non Chatacterized Hit- tr|I1JHJ9|I1JHJ9_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.58562
PE,85.4,0,SUBFAMILY NOT NAMED,NULL; FAMILY NOT NAMED,NULL;
Heme-dependent peroxidases,Haem peroxidase; peroxid,CUFF.38919.1
(969 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC80986 similar to UniRef100_Q41324 Cluster: Cationic p... 84 2e-15
gnl|LJGI|TC81109 similar to UniRef100_Q9XFL4 Cluster: Peroxidase... 70 3e-11
gnl|LJGI|TC57867 similar to UniRef100_Q9XFL4 Cluster: Peroxidase... 70 3e-11
gnl|LJGI|TC61108 similar to UniRef100_Q43387 Cluster: Peroxidase... 66 4e-10
gnl|LJGI|DC595608 similar to UniRef100_Q41324 Cluster: Cationic ... 60 3e-08
gnl|LJGI|TC59155 similar to UniRef100_P22195 Cluster: Cationic p... 60 3e-08
gnl|LJGI|AV418590 weakly similar to UniRef100_Q9SSZ7 Cluster: Pe... 58 1e-07
gnl|LJGI|TC70258 similar to UniRef100_A7P9E3 Cluster: Chromosome... 58 1e-07
gnl|LJGI|DC599808 similar to UniRef100_Q41324 Cluster: Cationic ... 56 4e-07
gnl|LJGI|AV415811 similar to UniRef100_Q8RVP4 Cluster: Bacterial... 56 4e-07
gnl|LJGI|TC61888 similar to UniRef100_P22196 Cluster: Cationic p... 56 4e-07
gnl|LJGI|TC61166 similar to UniRef100_Q9XFL6 Cluster: Peroxidase... 56 4e-07
gnl|LJGI|TC57505 similar to UniRef100_P22196 Cluster: Cationic p... 56 4e-07
gnl|LJGI|TC80421 similar to UniRef100_P22195 Cluster: Cationic p... 54 2e-06
gnl|LJGI|TC69822 similar to UniRef100_Q9XFI7 Cluster: Peroxidase... 54 2e-06
gnl|LJGI|TC68620 similar to UniRef100_Q41324 Cluster: Cationic p... 54 2e-06
gnl|LJGI|TC79328 similar to UniRef100_Q43790 Cluster: Peroxidase... 52 7e-06
gnl|LJGI|TC62405 similar to UniRef100_P22195 Cluster: Cationic p... 52 7e-06
>gnl|LJGI|TC80986 similar to UniRef100_Q41324 Cluster: Cationic peroxidase; n=1;
Stylosanthes humilis|Rep: Cationic peroxidase -
Stylosanthes humilis (Townsville stylo), partial (95%)
Length = 1291
Score = 83.8 bits (42), Expect = 2e-15
Identities = 180/224 (80%), Gaps = 4/224 (1%)
Strand = Plus / Plus
Query: 175 atgggcgcctccttgctccgtcttcatttccatgactgttttgttaatggatgtgatgcc 234
||||| || ||| |||||||||||||||||||||| || || || | |||||||||||
Sbjct: 259 atgggagcttccctgctccgtcttcatttccatgattgcttcgtccaaggatgtgatgca 318
Query: 235 tctgttctattagatgacacatccaccttcacgggagagaagtcagctggtgcaaatgtg 294
|| | || || ||||||||||| | ||||| || |||||| |||||||| | ||||
Sbjct: 319 tcaatactgttggatgacacatcgaatttcacaggtgagaagacagctggtcccaatgct 378
Query: 295 aattctctcagaggttttgaagtaattgatgacattaagactaaagtggaggctgcttgt 354
|||||| | ||||||||||| ||||| || ||| ||| ||||||||||| ||||||
Sbjct: 379 aattctgtgagaggttttgatgtaatagacaccatcaagtctaaagtggag--agcttgt 436
Query: 355 --cctggtgttgtttcttgtgcagatattgtagctgttgctgct 396
||||||||||| |||||||| ||||| || ||||| ||||||
Sbjct: 437 gccctggtgttgtctcttgtgctgatatcgttgctgtagctgct 480
>gnl|LJGI|TC81109 similar to UniRef100_Q9XFL4 Cluster: Peroxidase 3; n=1; Phaseolus
vulgaris|Rep: Peroxidase 3 - Phaseolus vulgaris (Kidney
bean) (French bean), partial (36%)
Length = 579
Score = 69.9 bits (35), Expect = 3e-11
Identities = 95/115 (82%)
Strand = Plus / Plus
Query: 295 aattctctcagaggttttgaagtaattgatgacattaagactaaagtggaggctgcttgt 354
|||||||| ||||| ||||| || ||||||| ||| ||| |||| |||||||| | ||
Sbjct: 446 aattctctgagaggctttgatgtcattgatgccataaagtctaaggtggaggcagtgtgc 505
Query: 355 cctggtgttgtttcttgtgcagatattgtagctgttgctgctcgtgattctgttg 409
|||||||| ||||| ||||| ||| |||| || ||||||||||||| |||||||
Sbjct: 506 cctggtgtggtttcatgtgctgatgttgttgccattgctgctcgtgactctgttg 560
>gnl|LJGI|TC57867 similar to UniRef100_Q9XFL4 Cluster: Peroxidase 3; n=1; Phaseolus
vulgaris|Rep: Peroxidase 3 - Phaseolus vulgaris (Kidney
bean) (French bean), partial (85%)
Length = 1329
Score = 69.9 bits (35), Expect = 3e-11
Identities = 95/115 (82%)
Strand = Plus / Plus
Query: 295 aattctctcagaggttttgaagtaattgatgacattaagactaaagtggaggctgcttgt 354
|||||||| ||||| ||||| || ||||||| ||| ||| |||| |||||||| | ||
Sbjct: 349 aattctctgagaggctttgatgtcattgatgccataaagtctaaggtggaggcagtgtgc 408
Query: 355 cctggtgttgtttcttgtgcagatattgtagctgttgctgctcgtgattctgttg 409
|||||||| ||||| ||||| ||| |||| || ||||||||||||| |||||||
Sbjct: 409 cctggtgtggtttcatgtgctgatgttgttgccattgctgctcgtgactctgttg 463
>gnl|LJGI|TC61108 similar to UniRef100_Q43387 Cluster: Peroxidase 71 precursor; n=1;
Arabidopsis thaliana|Rep: Peroxidase 71 precursor -
Arabidopsis thaliana (Mouse-ear cress), partial (65%)
Length = 1340
Score = 65.9 bits (33), Expect = 4e-10
Identities = 51/57 (89%)
Strand = Plus / Plus
Query: 355 cctggtgttgtttcttgtgcagatattgtagctgttgctgctcgtgattctgttgtt 411
||||||||||| || ||||| |||||| | ||| |||||||||||||||||||||||
Sbjct: 430 cctggtgttgtgtcctgtgctgatattcttgctcttgctgctcgtgattctgttgtt 486
>gnl|LJGI|DC595608 similar to UniRef100_Q41324 Cluster: Cationic peroxidase; n=1;
Stylosanthes humilis|Rep: Cationic peroxidase -
Stylosanthes humilis (Townsville stylo), partial (26%)
Length = 390
Score = 60.0 bits (30), Expect = 3e-08
Identities = 54/62 (87%)
Strand = Plus / Plus
Query: 172 cgtatgggcgcctccttgctccgtcttcatttccatgactgttttgttaatggatgtgat 231
|||||||| || ||| |||||||||| ||||||||||| |||||||| | |||||||||
Sbjct: 254 cgtatgggagcatccctgctccgtctccatttccatgattgttttgtccaaggatgtgat 313
Query: 232 gc 233
||
Sbjct: 314 gc 315
>gnl|LJGI|TC59155 similar to UniRef100_P22195 Cluster: Cationic peroxidase 1
precursor; n=1; Arachis hypogaea|Rep: Cationic
peroxidase 1 precursor - Arachis hypogaea (Peanut),
partial (96%)
Length = 1209
Score = 60.0 bits (30), Expect = 3e-08
Identities = 81/98 (82%)
Strand = Plus / Plus
Query: 188 tgctccgtcttcatttccatgactgttttgttaatggatgtgatgcctctgttctattag 247
|||||||||||||||||||||| || |||||| | || |||||||| || | || || |
Sbjct: 249 tgctccgtcttcatttccatgattgctttgttcaaggttgtgatgcatcaatactgttgg 308
Query: 248 atgacacatccaccttcacgggagagaagtcagctggt 285
|||||||||| | ||||| || |||||| ||||||||
Sbjct: 309 atgacacatctagtttcacaggtgagaagacagctggt 346
>gnl|LJGI|AV418590 weakly similar to UniRef100_Q9SSZ7 Cluster: Peroxidase 3; n=1;
Scutellaria baicalensis|Rep: Peroxidase 3 - Scutellaria
baicalensis (Baical skullcap), partial (21%)
Length = 424
Score = 58.0 bits (29), Expect = 1e-07
Identities = 35/37 (94%)
Strand = Plus / Plus
Query: 196 cttcatttccatgactgttttgttaatggatgtgatg 232
|||||||||||||| |||||||| |||||||||||||
Sbjct: 336 cttcatttccatgattgttttgtcaatggatgtgatg 372
>gnl|LJGI|TC70258 similar to UniRef100_A7P9E3 Cluster: Chromosome chr3 scaffold_8,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr3 scaffold_8, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (68%)
Length = 1259
Score = 58.0 bits (29), Expect = 1e-07
Identities = 35/37 (94%)
Strand = Plus / Plus
Query: 196 cttcatttccatgactgttttgttaatggatgtgatg 232
|||||||||||||| |||||||| |||||||||||||
Sbjct: 256 cttcatttccatgattgttttgtcaatggatgtgatg 292
>gnl|LJGI|DC599808 similar to UniRef100_Q41324 Cluster: Cationic peroxidase; n=1;
Stylosanthes humilis|Rep: Cationic peroxidase -
Stylosanthes humilis (Townsville stylo), partial (43%)
Length = 562
Score = 56.0 bits (28), Expect = 4e-07
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 175 atgggcgcctccttgctccgtcttcatttccatgactgttttgt 218
||||| || |||||||||||||||||||||||||| || |||||
Sbjct: 249 atgggtgcatccttgctccgtcttcatttccatgattgctttgt 292
>gnl|LJGI|AV415811 similar to UniRef100_Q8RVP4 Cluster: Bacterial-induced class III
peroxidase; n=1; Gossypium hirsutum|Rep:
Bacterial-induced class III peroxidase - Gossypium
hirsutum (Upland cotton) (Gossypium mexicanum), partial
(15%)
Length = 260
Score = 56.0 bits (28), Expect = 4e-07
Identities = 61/72 (84%)
Strand = Plus / Plus
Query: 340 gtggaggctgcttgtcctggtgttgtttcttgtgcagatattgtagctgttgctgctcgt 399
|||||||||||||| || |||||||| ||||| || ||||| | || |||||||||||
Sbjct: 74 gtggaggctgcttgccccggtgttgtgtcttgcgctgatatccttgcccttgctgctcgt 133
Query: 400 gattctgttgtt 411
||||| ||||||
Sbjct: 134 gattccgttgtt 145
>gnl|LJGI|TC61888 similar to UniRef100_P22196 Cluster: Cationic peroxidase 2
precursor; n=1; Arachis hypogaea|Rep: Cationic
peroxidase 2 precursor - Arachis hypogaea (Peanut),
partial (45%)
Length = 757
Score = 56.0 bits (28), Expect = 4e-07
Identities = 61/72 (84%)
Strand = Plus / Plus
Query: 340 gtggaggctgcttgtcctggtgttgtttcttgtgcagatattgtagctgttgctgctcgt 399
|||||||||||||| || |||||||| ||||| || ||||| | || |||||||||||
Sbjct: 525 gtggaggctgcttgccccggtgttgtgtcttgcgctgatatccttgcccttgctgctcgt 584
Query: 400 gattctgttgtt 411
||||| ||||||
Sbjct: 585 gattccgttgtt 596
>gnl|LJGI|TC61166 similar to UniRef100_Q9XFL6 Cluster: Peroxidase 5; n=1; Phaseolus
vulgaris|Rep: Peroxidase 5 - Phaseolus vulgaris (Kidney
bean) (French bean), partial (93%)
Length = 1309
Score = 56.0 bits (28), Expect = 4e-07
Identities = 37/40 (92%)
Strand = Plus / Plus
Query: 193 cgtcttcatttccatgactgttttgttaatggatgtgatg 232
||||||||||| ||||| || |||||||||||||||||||
Sbjct: 248 cgtcttcattttcatgattgctttgttaatggatgtgatg 287
>gnl|LJGI|TC57505 similar to UniRef100_P22196 Cluster: Cationic peroxidase 2
precursor; n=1; Arachis hypogaea|Rep: Cationic
peroxidase 2 precursor - Arachis hypogaea (Peanut),
partial (89%)
Length = 1362
Score = 56.0 bits (28), Expect = 4e-07
Identities = 61/72 (84%)
Strand = Plus / Plus
Query: 340 gtggaggctgcttgtcctggtgttgtttcttgtgcagatattgtagctgttgctgctcgt 399
|||||||||||||| || |||||||| ||||| || ||||| | || |||||||||||
Sbjct: 452 gtggaggctgcttgccccggtgttgtgtcttgcgctgatatccttgcccttgctgctcgt 511
Query: 400 gattctgttgtt 411
||||| ||||||
Sbjct: 512 gattccgttgtt 523
>gnl|LJGI|TC80421 similar to UniRef100_P22195 Cluster: Cationic peroxidase 1
precursor; n=1; Arachis hypogaea|Rep: Cationic
peroxidase 1 precursor - Arachis hypogaea (Peanut),
partial (61%)
Length = 734
Score = 54.0 bits (27), Expect = 2e-06
Identities = 60/71 (84%)
Strand = Plus / Plus
Query: 163 aaagagcaccgtatgggcgcctccttgctccgtcttcatttccatgactgttttgttaat 222
||||||| ||| ||||| || |||||||| || || ||||||||||| || |||||| |
Sbjct: 231 aaagagccccgcatgggggcatccttgcttcgactccatttccatgattgctttgttcaa 290
Query: 223 ggatgtgatgc 233
|||||||||||
Sbjct: 291 ggatgtgatgc 301
>gnl|LJGI|TC69822 similar to UniRef100_Q9XFI7 Cluster: Peroxidase; n=1; Glycine
max|Rep: Peroxidase - Glycine max (Soybean), partial
(92%)
Length = 1245
Score = 54.0 bits (27), Expect = 2e-06
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 186 cttgctccgtcttcatttccatgactgttttgttaatggatgtgatg 232
||||||| | |||||||| ||||||||||||||| | ||||||||||
Sbjct: 265 cttgctcaggcttcattttcatgactgttttgttgagggatgtgatg 311
>gnl|LJGI|TC68620 similar to UniRef100_Q41324 Cluster: Cationic peroxidase; n=1;
Stylosanthes humilis|Rep: Cationic peroxidase -
Stylosanthes humilis (Townsville stylo), partial (19%)
Length = 970
Score = 54.0 bits (27), Expect = 2e-06
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 172 cgtatgggcgcctccttgctccgtcttcatttccatgactgttttgt 218
|||||||| || ||| |||||||||| ||||||||||| ||||||||
Sbjct: 282 cgtatgggagcatccctgctccgtctccatttccatgattgttttgt 328
>gnl|LJGI|TC79328 similar to UniRef100_Q43790 Cluster: Peroxidase1B precursor; n=1;
Medicago sativa|Rep: Peroxidase1B precursor - Medicago
sativa (Alfalfa), partial (95%)
Length = 1380
Score = 52.0 bits (26), Expect = 7e-06
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 196 cttcatttccatgactgttttgttaatggatgtgatgc 233
|||||||||||||||||||||||| | || ||||||||
Sbjct: 243 cttcatttccatgactgttttgttcaagggtgtgatgc 280
>gnl|LJGI|TC62405 similar to UniRef100_P22195 Cluster: Cationic peroxidase 1
precursor; n=1; Arachis hypogaea|Rep: Cationic
peroxidase 1 precursor - Arachis hypogaea (Peanut),
partial (81%)
Length = 896
Score = 52.0 bits (26), Expect = 7e-06
Identities = 26/26 (100%)
Strand = Plus / Plus
Query: 445 ggcagaagagattcaaccacagcaag 470
||||||||||||||||||||||||||
Sbjct: 248 ggcagaagagattcaaccacagcaag 273