Miyakogusa Predicted Gene

Lj2g3v1390580.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v1390580.1 Non Chatacterized Hit- tr|I1J5A7|I1J5A7_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.56426
PE,81.56,0,K_trans,K+ potassium transporter; seg,NULL; kup: potassium
uptake protein,K+ potassium transporter; ,CUFF.36956.1
         (2328 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS342385 homologue to UniRef100_A7Q2E3 Cluster: Chromos...    68   3e-10

>gnl|LJGI|FS342385 homologue to UniRef100_A7Q2E3 Cluster: Chromosome chr1 scaffold_46,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr1 scaffold_46, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (18%)
          Length = 573

 Score = 67.9 bits (34), Expect = 3e-10
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                       
Query: 430 gagaagcataaggttctgcagaggattttgcttgttttggctttgattggaacttgcatg 489
           |||||||| | ||| ||||||||| |  | |||||| |||||||||| || |||||||||
Sbjct: 454 gagaagcacagggtgctgcagagggtccttcttgttctggctttgatagggacttgcatg 513

                         
Query: 490 gtcattggtgatgg 503
           ||||||||||||||
Sbjct: 514 gtcattggtgatgg 527