Miyakogusa Predicted Gene

Lj2g3v0717080.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj2g3v0717080.1 Non Chatacterized Hit- tr|B9SFY4|B9SFY4_RICCO
Putative uncharacterized protein OS=Ricinus communis
G,38.1,0.00000004,WAK_assoc,NULL,
NODE_75154_length_606_cov_46.064358.path2.1
         (376 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC81592 similar to UniRef100_Q5C6G0 Cluster: SJCHGC0468...    94   7e-19

>gnl|LJGI|TC81592 similar to UniRef100_Q5C6G0 Cluster: SJCHGC04685 protein; n=1;
           Schistosoma japonicum|Rep: SJCHGC04685 protein -
           Schistosoma japonicum (Blood fluke), partial (12%)
          Length = 454

 Score = 93.7 bits (47), Expect = 7e-19
 Identities = 84/95 (88%), Gaps = 1/95 (1%)
 Strand = Plus / Minus

                                                                       
Query: 131 gatttgaggttgggtggagtggagtggatggagataaatgtgatggatgcacaaaatctg 190
           ||||||||||| |||| ||||  ||||||||||| ||||||||||| || || |||| | 
Sbjct: 416 gatttgaggttaggtgcagtgt-gtggatggagacaaatgtgatggttgtacgaaatttt 358

                                              
Query: 191 gtgggagatgtggatacaatacatctctaaatgca 225
           |||||||||||||||||||||||||| ||||||||
Sbjct: 357 gtgggagatgtggatacaatacatctataaatgca 323