Miyakogusa Predicted Gene

Lj1g3v4838310.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v4838310.1 68531_g.1
         (232 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC64093                                                      135   1e-31

>gnl|LJGI|TC64093 
          Length = 686

 Score =  135 bits (68), Expect = 1e-31
 Identities = 93/100 (93%), Gaps = 1/100 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggaaaaattgcctggacgcttgtattcactccctgtgatgtctttggggcctgctgtc 60
           |||||||||||||||||| ||||||||||||||||||||||||||| |||| ||||||||
Sbjct: 134 atggaaaaattgcctggaagcttgtattcactccctgtgatgtcttgggggtctgctgtc 193

                                                   
Query: 61  ttgcttgtggtgctgttgtcatgtttgggg-gttgctgtc 99
           ||||||||||||||| | ||||| |||||| |||||||||
Sbjct: 194 ttgcttgtggtgctgctatcatgcttggggagttgctgtc 233



 Score = 58.0 bits (29), Expect = 2e-08
 Identities = 53/61 (86%)
 Strand = Plus / Plus

                                                                       
Query: 169 tgtttggtgtggaaaagagcttcacgagctggtataatgcagcaacaggtacagagcctt 228
           ||||||||||||||||| | |||| |||||||| || ||  ||||||||||||||| |||
Sbjct: 433 tgtttggtgtggaaaagtgattcaggagctggtttattgttgcaacaggtacagaggctt 492

            
Query: 229 g 229
           |
Sbjct: 493 g 493