Miyakogusa Predicted Gene

Lj1g3v3137840.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj1g3v3137840.1 Non Chatacterized Hit- tr|I7AHE7|I7AHE7_SOYBN
Putative Mei2 protein (Fragment) OS=Glycine max PE=4 S,42.86,2e-17,no
description,Nucleotide-binding, alpha-beta plait; SUBFAMILY NOT
NAMED,NULL; FAMILY NOT NAMED,NULL,CUFF.30118.1
         (2220 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC64908 homologue to UniRef100_Q6J739 Cluster: AML1; n=...    64   4e-09
gnl|LJGI|TC60430 similar to UniRef100_A7PHR4 Cluster: Chromosome...    56   1e-06

>gnl|LJGI|TC64908 homologue to UniRef100_Q6J739 Cluster: AML1; n=1; Medicago
            truncatula|Rep: AML1 - Medicago truncatula (Barrel
            medic), partial (14%)
          Length = 1116

 Score = 63.9 bits (32), Expect = 4e-09
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1948 aatggaaagaaatgggagaaatttaacagcgagaaagtggcatcactagcatatgctcgc 2007
            ||||| |||||||||||||||||||| || || ||||| || || ||||||||||| || 
Sbjct: 67   aatgggaagaaatgggagaaatttaatagtgaaaaagttgcttcgctagcatatgcacgg 126

                    
Query: 2008 atacaagg 2015
            ||||||||
Sbjct: 127  atacaagg 134


>gnl|LJGI|TC60430 similar to UniRef100_A7PHR4 Cluster: Chromosome chr17 scaffold_16,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr17 scaffold_16, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (9%)
          Length = 858

 Score = 56.0 bits (28), Expect = 1e-06
 Identities = 85/104 (81%)
 Strand = Plus / Plus

                                                                        
Query: 2029 attgctcacttccaaaattcaagcttgatgaatgaggataagcgctgcaggcccatcctg 2088
            |||||||| ||||| ||||||||| ||||||| || ||||| || ||| | || || || 
Sbjct: 44   attgctcatttccagaattcaagcctgatgaacgaagataaacgatgccgccctattctc 103

                                                        
Query: 2089 ttcaatgctgatggccctaatgctggtgatcaggttcctttccc 2132
            ||| || | |||||||| ||||||||||||| ||  ||||||||
Sbjct: 104  ttccatacagatggcccaaatgctggtgatccggaacctttccc 147