Miyakogusa Predicted Gene

Lj0g3v0336229.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0336229.1 Non Chatacterized Hit- tr|I1JLB0|I1JLB0_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max
PE=4,70.8,0,RNI-like,NULL; L domain-like,NULL; Leucine-rich repeats,
typical (most populate,Leucine-rich repeat,,CUFF.22999.1
         (2409 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC76701 weakly similar to UniRef100_A7QKY8 Cluster: Chr...   167   4e-40
gnl|LJGI|BW632259 weakly similar to UniRef100_A7QKY8 Cluster: Ch...    60   7e-08

>gnl|LJGI|TC76701 weakly similar to UniRef100_A7QKY8 Cluster: Chromosome chr8
            scaffold_115, whole genome shotgun sequence; n=1; Vitis
            vinifera|Rep: Chromosome chr8 scaffold_115, whole genome
            shotgun sequence - Vitis vinifera (Grape), partial (20%)
          Length = 724

 Score =  167 bits (84), Expect = 4e-40
 Identities = 102/108 (94%)
 Strand = Plus / Plus

                                                                        
Query: 2292 atccacactccgagtcttggtcttgagtaaaaacaaattccatggtcccattggatgtcc 2351
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3    atccacactccgagtcttggtcttgagtaaaaacaaattccatggtcccattggatgtcc 62

                                                            
Query: 2352 acagcataatgacaccgggaaaaggcttcagatagttgatctagcctt 2399
             ||| ||||||  ||  |||||||||||||||||||||||||||||||
Sbjct: 63   ccagaataatggtacttggaaaaggcttcagatagttgatctagcctt 110


>gnl|LJGI|BW632259 weakly similar to UniRef100_A7QKY8 Cluster: Chromosome chr8
            scaffold_115, whole genome shotgun sequence; n=1; Vitis
            vinifera|Rep: Chromosome chr8 scaffold_115, whole genome
            shotgun sequence - Vitis vinifera (Grape), partial (13%)
          Length = 480

 Score = 60.0 bits (30), Expect = 7e-08
 Identities = 75/90 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2262 tgatggctttccatgcatgttgaagaacatatccacactccgagtcttggtcttgagtaa 2321
            |||||| ||||||||| | ||||||   |||||||||||||| ||| |||| ||| |   
Sbjct: 247  tgatggatttccatgcttcttgaagccaatatccacactccgtgtcatggttttgcgggg 306

                                          
Query: 2322 aaacaaattccatggtcccattggatgtcc 2351
            |||||||||| | |||||||||||||||||
Sbjct: 307  aaacaaattcgacggtcccattggatgtcc 336