Miyakogusa Predicted Gene
- Lj0g3v0328459.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0328459.1 tr|I1JXB2|I1JXB2_SOYBN Cytosine-specific
methyltransferase OS=Glycine max GN=Gma.13821 PE=3 SV=1,72.47,0,Bromo
adjacent homology domain,Bromo adjacent homology (BAH) domain; DNA
(CYTOSINE-5)-METHYLTRANSFER,CUFF.22357.1
(2352 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC65549 similar to UniRef100_O49022 Cluster: Cytosine-s... 103 5e-21
>gnl|LJGI|TC65549 similar to UniRef100_O49022 Cluster: Cytosine-specific
methyltransferase; n=1; Pisum sativum|Rep:
Cytosine-specific methyltransferase - Pisum sativum
(Garden pea), partial (18%)
Length = 1054
Score = 103 bits (52), Expect = 5e-21
Identities = 139/168 (82%)
Strand = Plus / Plus
Query: 5 gtggtagcaagtatttttctggaactgcatttgcaaaggattttgtcatttctcaaggtg 64
|||| ||||||| || ||||||||||||| | ||| |||||||| |||||||| || |
Sbjct: 825 gtggcagcaagttcttctctggaactgcatctctaaaagattttgttatttctcagggcg 884
Query: 65 agtttattcataagcagctgataggattagatgtcacatccaagcaaaatgacaggatgt 124
|||||||| |||||||||| ||||| ||||| | || |||| |||||||| |||||
Sbjct: 885 agtttatttataagcagctcataggtttagacatgtcagacaagacaaatgacaagatgt 944
Query: 125 ttgcaaatattcctgtgcttgctgctcttagagatgagagtaagaaac 172
||||| ||||||||| |||| ||||||||||||||||||||||||
Sbjct: 945 ttgcagatattcctgctcttgtctctcttagagatgagagtaagaaac 992