Miyakogusa Predicted Gene

Lj0g3v0269339.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0269339.1 Non Chatacterized Hit- tr|B9STV7|B9STV7_RICCO
Bel1 homeotic protein, putative OS=Ricinus communis
GN,48.84,0.00000000005,Homeodomain-like,Homeodomain-like; domain
associated with HOX domains,POX; Homeodomain,Homeodomain;
,CUFF.17790.1
         (2148 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC59712 homologue to UniRef100_A7NT59 Cluster: Chromoso...    60   6e-08

>gnl|LJGI|TC59712 homologue to UniRef100_A7NT59 Cluster: Chromosome chr18 scaffold_1,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr18 scaffold_1, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (7%)
          Length = 951

 Score = 60.0 bits (30), Expect = 6e-08
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1633 aaccaggtatcaaattggttcatcaatgctcgtgtccgcgtgtggaagccaatggttgag 1692
            ||||||||  |||||||||||||||||||  | || ||  | ||||||||||||||||||
Sbjct: 53   aaccaggtggcaaattggttcatcaatgcaagggtgcgtctttggaagccaatggttgag 112

                  
Query: 1693 gaaata 1698
            ||||||
Sbjct: 113  gaaata 118