Miyakogusa Predicted Gene
- Lj0g3v0269339.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0269339.1 Non Chatacterized Hit- tr|B9STV7|B9STV7_RICCO
Bel1 homeotic protein, putative OS=Ricinus communis
GN,48.84,0.00000000005,Homeodomain-like,Homeodomain-like; domain
associated with HOX domains,POX; Homeodomain,Homeodomain;
,CUFF.17790.1
(2148 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC59712 homologue to UniRef100_A7NT59 Cluster: Chromoso... 60 6e-08
>gnl|LJGI|TC59712 homologue to UniRef100_A7NT59 Cluster: Chromosome chr18 scaffold_1,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr18 scaffold_1, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (7%)
Length = 951
Score = 60.0 bits (30), Expect = 6e-08
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 1633 aaccaggtatcaaattggttcatcaatgctcgtgtccgcgtgtggaagccaatggttgag 1692
|||||||| ||||||||||||||||||| | || || | ||||||||||||||||||
Sbjct: 53 aaccaggtggcaaattggttcatcaatgcaagggtgcgtctttggaagccaatggttgag 112
Query: 1693 gaaata 1698
||||||
Sbjct: 113 gaaata 118