Miyakogusa Predicted Gene

Lj0g3v0248519.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0248519.1 Non Chatacterized Hit- tr|H9KL90|H9KL90_APIME
Uncharacterized protein OS=Apis mellifera GN=Ame.2219
,51.52,3,seg,NULL,CUFF.16235.1
         (195 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW605256 similar to UniRef100_Q4T334 Cluster: Chromosom...   212   6e-55
gnl|LJGI|FS343230 similar to UniRef100_Q6DXR5 Cluster: Predicted...    96   9e-20
gnl|LJGI|DC595566 weakly similar to UniRef100_Q3T7B3 Cluster: Vi...    90   6e-18
gnl|LJGI|TC65699 weakly similar to UniRef100_Q9CDJ6 Cluster: Glu...    72   1e-12

>gnl|LJGI|BW605256 similar to UniRef100_Q4T334 Cluster: Chromosome undetermined
           SCAF10125, whole genome shotgun sequence; n=1; Tetraodon
           nigroviridis|Rep: Chromosome undetermined SCAF10125,
           whole genome shotgun sequence - Tetraodon nigroviridis
           (Green puffer), partial (8%)
          Length = 486

 Score =  212 bits (107), Expect = 6e-55
 Identities = 119/122 (97%), Gaps = 2/122 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   atgattggcggaggagtgaggggggtggtgaccagagaacttacatggtggaggttg--g 58
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |
Sbjct: 196 atgattggcggaggagtgaggggggtggtgaccagagaacttacatggtggaggttgtgg 137

                                                                       
Query: 59  gtcgtttaaatggggaggtggctggagtggtggccggagggggtggagttctgggttttt 118
           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 136 gtcgtttaaatggggaggtggctggagtggtggccgaagggggtggagttctgggttttt 77

             
Query: 119 gg 120
           ||
Sbjct: 76  gg 75


>gnl|LJGI|FS343230 similar to UniRef100_Q6DXR5 Cluster: Predicted protein; n=1;
           Gossypium hirsutum|Rep: Predicted protein - Gossypium
           hirsutum (Upland cotton) (Gossypium mexicanum), partial
           (5%)
          Length = 708

 Score = 95.6 bits (48), Expect = 9e-20
 Identities = 74/80 (92%), Gaps = 2/80 (2%)
 Strand = Plus / Minus

                                                                       
Query: 41  ttacatggtggaggttgggtcgtttaaatg-gggaggtggctggagtggtggccggaggg 99
           |||| ||||||||||||| ||||||||||| ||||||||||||||||||||| |||| | 
Sbjct: 79  ttacgtggtggaggttgg-tcgtttaaatgtgggaggtggctggagtggtggtcggatga 21

                               
Query: 100 ggtggagttctgggtttttg 119
           ||||||||||||||||||||
Sbjct: 20  ggtggagttctgggtttttg 1


>gnl|LJGI|DC595566 weakly similar to UniRef100_Q3T7B3 Cluster: Vitellogenin 2; n=2;
           Danio rerio|Rep: Vitellogenin 2 - Danio rerio
           (Zebrafish) (Brachydanio rerio), partial (4%)
          Length = 476

 Score = 89.7 bits (45), Expect = 6e-18
 Identities = 74/81 (91%), Gaps = 2/81 (2%)
 Strand = Plus / Minus

                                                                       
Query: 41  ttacatggtggaggttgggtcgtttaaatgggg-aggtggctggagtggtggccggaggg 99
           |||| ||||||||||||| ||||||||||| || |||||||||||||||||| |||| | 
Sbjct: 114 ttacgtggtggaggttgg-tcgtttaaatgtggcaggtggctggagtggtggtcggatga 56

                                
Query: 100 ggtggagttctgggtttttgg 120
           |||||||||||||||||||||
Sbjct: 55  ggtggagttctgggtttttgg 35


>gnl|LJGI|TC65699 weakly similar to UniRef100_Q9CDJ6 Cluster: Glucosyltransferase-S;
           n=1; Lactococcus lactis subsp. lactis|Rep:
           Glucosyltransferase-S - Lactococcus lactis subsp. lactis
           (Streptococcus lactis), partial (7%)
          Length = 888

 Score = 71.9 bits (36), Expect = 1e-12
 Identities = 71/80 (88%), Gaps = 2/80 (2%)
 Strand = Plus / Minus

                                                                       
Query: 41  ttacatggtggaggttgggtcgtttaaatggggaggtggctggagtggtggccggagggg 100
           |||| ||||||||||||| |  |||||||||||||||| ||||||| |||| |||| || 
Sbjct: 149 ttacgtggtggaggttggtta-tttaaatggggaggtg-ctggagtagtggtcggatggt 92

                               
Query: 101 gtggagttctgggtttttgg 120
           ||||||||||||||||||||
Sbjct: 91  gtggagttctgggtttttgg 72