Miyakogusa Predicted Gene

Lj0g3v0230909.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0230909.1 Non Chatacterized Hit- tr|I3S289|I3S289_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=4
SV=1,84.78,1e-16,LSM,Ribonucleoprotein LSM domain; SMALL NUCLEAR
RIBONUCLEOPROTEIN,NULL; no description,NULL; Sm-like,CUFF.15096.1
         (141 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC68860 homologue to UniRef100_Q2HTF4 Cluster: Like-Sm ...   264   1e-70
gnl|LJGI|TC66345 homologue to UniRef100_Q2HTF4 Cluster: Like-Sm ...   107   2e-23

>gnl|LJGI|TC68860 homologue to UniRef100_Q2HTF4 Cluster: Like-Sm
           ribonucleoprotein-related, core; n=1; Medicago
           truncatula|Rep: Like-Sm ribonucleoprotein-related, core
           - Medicago truncatula (Barrel medic), partial (95%)
          Length = 540

 Score =  264 bits (133), Expect = 1e-70
 Identities = 139/141 (98%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgagcaggtcagggcaacccccggatttgaagaaatacatggacaagaatcttcagatc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 90  atgagcaggtcagggcaacccccggatttgaagaaatacatggacaagaatcttcagatc 149

                                                                       
Query: 61  aagctgaatgcaaatcggatgattattggtactctccggggcttcgataagtttatgaat 120
           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 150 aagctgaatgcaaatcggatgattattggtactctccggggcttcgatcagtttatgaat 209

                                
Query: 121 ttagtgattgacaacactgtg 141
           ||||| |||||||||||||||
Sbjct: 210 ttagttattgacaacactgtg 230


>gnl|LJGI|TC66345 homologue to UniRef100_Q2HTF4 Cluster: Like-Sm
           ribonucleoprotein-related, core; n=1; Medicago
           truncatula|Rep: Like-Sm ribonucleoprotein-related, core
           - Medicago truncatula (Barrel medic), partial (98%)
          Length = 621

 Score =  107 bits (54), Expect = 2e-23
 Identities = 87/98 (88%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgagcaggtcagggcaacccccggatttgaagaaatacatggacaagaatcttcagatc 60
           |||||||||||||| || || || ||||||||||| |||||||||||||||||||| || 
Sbjct: 76  atgagcaggtcaggacagccaccagatttgaagaagtacatggacaagaatcttcaaatt 135

                                                 
Query: 61  aagctgaatgcaaatcggatgattattggtactctccg 98
           ||||||||||||||||| |||||| |||| || |||||
Sbjct: 136 aagctgaatgcaaatcgcatgattgttggcaccctccg 173