Miyakogusa Predicted Gene

Lj0g3v0224599.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0224599.2 Non Chatacterized Hit- tr|C6TM69|C6TM69_SOYBN
Putative uncharacterized protein OS=Glycine max PE=2
S,86.89,0,Branch,Glycosyl transferase, family 14; GLYCOSYLATION
ENZYME-LIKE PROTEIN,NULL; GLYCOSYLTRANSFERASE ,CUFF.14624.2
         (801 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC61542 similar to UniRef100_A7PML1 Cluster: Chromosome...    60   2e-08

>gnl|LJGI|TC61542 similar to UniRef100_A7PML1 Cluster: Chromosome chr14 scaffold_21,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr14 scaffold_21, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (96%)
          Length = 2064

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 97  gattgggactggtttgtcaatcttagtgcctctgatta 134
           ||||||||||||||| ||||||| ||||||||||||||
Sbjct: 722 gattgggactggtttatcaatctcagtgcctctgatta 759