Miyakogusa Predicted Gene
- Lj0g3v0129529.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0129529.1 tr|Q8S950|Q8S950_TOBAC Kinesin-like protein NACK1
OS=Nicotiana tabacum GN=nack1 PE=1 SV=1,46.34,1e-17,seg,NULL;
coiled-coil,NULL; DUF3490,Protein of unknown function DUF3490; P-loop
containing nucleosid,CUFF.7839.1
(1935 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC75555 weakly similar to UniRef100_UPI0000196FBC Clust... 161 2e-38
gnl|LJGI|BP052607 weakly similar to UniRef100_UPI0000196FBC Clus... 72 1e-11
gnl|LJGI|FS349603 UniRef100_UPI00004D6DFC Cluster: Probable E3 u... 62 1e-08
>gnl|LJGI|TC75555 weakly similar to UniRef100_UPI0000196FBC Cluster: kinesin motor
family protein; n=1; Arabidopsis thaliana|Rep: kinesin
motor family protein - Arabidopsis thaliana, partial
(11%)
Length = 653
Score = 161 bits (81), Expect = 2e-38
Identities = 288/357 (80%)
Strand = Plus / Plus
Query: 1577 tggaaaatggacgaacccttacccctgaatcaagcacgagatgtcttcgaagagagagac 1636
||||| ||||||||||||| |||||||| ||||||| ||||| |||| ||||||||| |
Sbjct: 1 tggaagatggacgaaccctgacccctgagtcaagcatgagatctcttaaaagagagaggc 60
Query: 1637 agatgttgagcaagcagatgcataggaggctgtcaaaatctgaaagagacaacctctatt 1696
||||||||||||||| ||||| | || ||| || |||||||||||| || || ||||
Sbjct: 61 agatgttgagcaagccaatgcagaagaagctatctaaatctgaaagaatgaatctatatt 120
Query: 1697 tgaagtggggtataagtaagagttcaaagcatagaaggttgcaattggcccaccgcctgt 1756
||| |||| | | || ||| | ||||| || || ||||| |||| || || ||||
Sbjct: 121 tgagatgggttcttcgtttgagcacgaagcacaggagtttgcagctggctcatcgtctgt 180
Query: 1757 ggtctgaaacagaggacatgaaccatattagagagagtgccaccattgtggcaaagctgg 1816
|||| || ||| |||||||| | || |||||||| ||||| || |||| ||||||||||
Sbjct: 181 ggtccgacacaaaggacatggagcacattagagatagtgcagcccttgttgcaaagctgg 240
Query: 1817 ttggttcagtagagccagatcaggcttttaaggagatgtttgggctcaacttcgccccac 1876
||||||| ||||||||||| || |||||||||||||||||||| |||||||| ||||| |
Sbjct: 241 ttggttcggtagagccagagcaagcttttaaggagatgtttggactcaactttgccccgc 300
Query: 1877 ggggcagaagaaagaaatcttttggttggacctccagcatgaagcatattttgtgag 1933
|| ||| | |||||||||||||||||| |||| ||| |||| |||||||||
Sbjct: 301 ggccttcaagtaggaaatcttttggttggacagccagtgtgaggcatcttttgtgag 357
>gnl|LJGI|BP052607 weakly similar to UniRef100_UPI0000196FBC Cluster: kinesin motor
family protein; n=1; Arabidopsis thaliana|Rep: kinesin
motor family protein - Arabidopsis thaliana, partial (9%)
Length = 466
Score = 71.9 bits (36), Expect = 1e-11
Identities = 102/124 (82%)
Strand = Plus / Minus
Query: 1810 aagctggttggttcagtagagccagatcaggcttttaaggagatgtttgggctcaacttc 1869
|||||||||||||| |||||||| || | |||||||||||||||||||| ||| ||||
Sbjct: 252 aagctggttggttcggtagagcccgagccagcttttaaggagatgtttggactccacttt 193
Query: 1870 gccccacggggcagaagaaagaaatcttttggttggacctccagcatgaagcatattttg 1929
||||| ||| | || | ||||||||||||||||||| || | ||| |||| |||||
Sbjct: 192 gccccgcggccctccagtaggaaatcttttggttggaccgcccgtgtgaggcatcttttg 133
Query: 1930 tgag 1933
||||
Sbjct: 132 tgag 129
>gnl|LJGI|FS349603 UniRef100_UPI00004D6DFC Cluster: Probable E3 ubiquitin-protein ligase
HERC2 (EC 6.3.2.-), partial (0%)
Length = 271
Score = 61.9 bits (31), Expect = 1e-08
Identities = 40/43 (93%)
Strand = Plus / Minus
Query: 1340 caaagaagttcaaagatgttggcttggacccattgcaatctga 1382
||||||| |||||||||||||||||||||||| ||||| ||||
Sbjct: 117 caaagaatttcaaagatgttggcttggacccaatgcaagctga 75