Miyakogusa Predicted Gene

Lj0g3v0055239.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj0g3v0055239.1 Non Chatacterized Hit- tr|F6GSN7|F6GSN7_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,43.81,0.0000000000001,
,NODE_45536_length_2480_cov_24.141129.path1.1
         (1416 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC82696 similar to UniRef100_A7QHY5 Cluster: Chromosome...    74   3e-12
gnl|LJGI|BP055644 weakly similar to UniRef100_A9RGE6 Cluster: Pr...    58   2e-07
gnl|LJGI|TC80541                                                       58   2e-07
gnl|LJGI|TC76376 similar to UniRef100_Q1JX87 Cluster: Cytochrome...    58   2e-07
gnl|LJGI|TC63699                                                       58   2e-07
gnl|LJGI|BP057320                                                      54   2e-06
gnl|LJGI|TC81515                                                       54   2e-06

>gnl|LJGI|TC82696 similar to UniRef100_A7QHY5 Cluster: Chromosome chr17 scaffold_101,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr17 scaffold_101, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (15%)
          Length = 741

 Score = 73.8 bits (37), Expect = 3e-12
 Identities = 40/41 (97%)
 Strand = Plus / Minus

                                                     
Query: 1376 tgataggaacccaattgttagggatatgcccaatactacta 1416
            |||||||||||||||||||||||||| ||||||||||||||
Sbjct: 174  tgataggaacccaattgttagggataggcccaatactacta 134


>gnl|LJGI|BP055644 weakly similar to UniRef100_A9RGE6 Cluster: Predicted protein; n=1;
            Physcomitrella patens subsp. patens|Rep: Predicted
            protein - Physcomitrella patens subsp. patens, partial
            (9%)
          Length = 551

 Score = 58.0 bits (29), Expect = 2e-07
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 1376 tgataggaacccaattgttagggatatgcccaatactacta 1416
            |||||||||||||||| ||||| ||| ||||||||||||||
Sbjct: 346  tgataggaacccaattattaggaataggcccaatactacta 306


>gnl|LJGI|TC80541 
          Length = 783

 Score = 58.0 bits (29), Expect = 2e-07
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                             
Query: 1336 tccatccttgaggacaaggatgttttgaagggg 1368
            |||||||||||||||||||||||||| ||||||
Sbjct: 434  tccatccttgaggacaaggatgttttcaagggg 466


>gnl|LJGI|TC76376 similar to UniRef100_Q1JX87 Cluster: Cytochrome c assembly protein;
            n=1; Desulfuromonas acetoxidans DSM 684|Rep: Cytochrome c
            assembly protein - Desulfuromonas acetoxidans DSM 684,
            partial (6%)
          Length = 1236

 Score = 58.0 bits (29), Expect = 2e-07
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                             
Query: 1336 tccatccttgaggacaaggatgttttgaagggg 1368
            |||||||||||||||||||||||||| ||||||
Sbjct: 938  tccatccttgaggacaaggatgttttcaagggg 970


>gnl|LJGI|TC63699 
          Length = 738

 Score = 58.0 bits (29), Expect = 2e-07
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                             
Query: 1336 tccatccttgaggacaaggatgttttgaagggg 1368
            |||||||||||||||||||||||||| ||||||
Sbjct: 453  tccatccttgaggacaaggatgttttcaagggg 485


>gnl|LJGI|BP057320 
          Length = 420

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 1338 catccttgaggacaaggatgttttgaagggg 1368
            |||||||||||||||||||||||| ||||||
Sbjct: 255  catccttgaggacaaggatgttttcaagggg 225


>gnl|LJGI|TC81515 
          Length = 474

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                           
Query: 1338 catccttgaggacaaggatgttttgaagggg 1368
            |||||||||||||||||||||||| ||||||
Sbjct: 184  catccttgaggacaaggatgttttcaagggg 214