Miyakogusa Predicted Gene
- Lj0g3v0055239.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj0g3v0055239.1 Non Chatacterized Hit- tr|F6GSN7|F6GSN7_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,43.81,0.0000000000001,
,NODE_45536_length_2480_cov_24.141129.path1.1
(1416 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC82696 similar to UniRef100_A7QHY5 Cluster: Chromosome... 74 3e-12
gnl|LJGI|BP055644 weakly similar to UniRef100_A9RGE6 Cluster: Pr... 58 2e-07
gnl|LJGI|TC80541 58 2e-07
gnl|LJGI|TC76376 similar to UniRef100_Q1JX87 Cluster: Cytochrome... 58 2e-07
gnl|LJGI|TC63699 58 2e-07
gnl|LJGI|BP057320 54 2e-06
gnl|LJGI|TC81515 54 2e-06
>gnl|LJGI|TC82696 similar to UniRef100_A7QHY5 Cluster: Chromosome chr17 scaffold_101,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr17 scaffold_101, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (15%)
Length = 741
Score = 73.8 bits (37), Expect = 3e-12
Identities = 40/41 (97%)
Strand = Plus / Minus
Query: 1376 tgataggaacccaattgttagggatatgcccaatactacta 1416
|||||||||||||||||||||||||| ||||||||||||||
Sbjct: 174 tgataggaacccaattgttagggataggcccaatactacta 134
>gnl|LJGI|BP055644 weakly similar to UniRef100_A9RGE6 Cluster: Predicted protein; n=1;
Physcomitrella patens subsp. patens|Rep: Predicted
protein - Physcomitrella patens subsp. patens, partial
(9%)
Length = 551
Score = 58.0 bits (29), Expect = 2e-07
Identities = 38/41 (92%)
Strand = Plus / Minus
Query: 1376 tgataggaacccaattgttagggatatgcccaatactacta 1416
|||||||||||||||| ||||| ||| ||||||||||||||
Sbjct: 346 tgataggaacccaattattaggaataggcccaatactacta 306
>gnl|LJGI|TC80541
Length = 783
Score = 58.0 bits (29), Expect = 2e-07
Identities = 32/33 (96%)
Strand = Plus / Plus
Query: 1336 tccatccttgaggacaaggatgttttgaagggg 1368
|||||||||||||||||||||||||| ||||||
Sbjct: 434 tccatccttgaggacaaggatgttttcaagggg 466
>gnl|LJGI|TC76376 similar to UniRef100_Q1JX87 Cluster: Cytochrome c assembly protein;
n=1; Desulfuromonas acetoxidans DSM 684|Rep: Cytochrome c
assembly protein - Desulfuromonas acetoxidans DSM 684,
partial (6%)
Length = 1236
Score = 58.0 bits (29), Expect = 2e-07
Identities = 32/33 (96%)
Strand = Plus / Plus
Query: 1336 tccatccttgaggacaaggatgttttgaagggg 1368
|||||||||||||||||||||||||| ||||||
Sbjct: 938 tccatccttgaggacaaggatgttttcaagggg 970
>gnl|LJGI|TC63699
Length = 738
Score = 58.0 bits (29), Expect = 2e-07
Identities = 32/33 (96%)
Strand = Plus / Plus
Query: 1336 tccatccttgaggacaaggatgttttgaagggg 1368
|||||||||||||||||||||||||| ||||||
Sbjct: 453 tccatccttgaggacaaggatgttttcaagggg 485
>gnl|LJGI|BP057320
Length = 420
Score = 54.0 bits (27), Expect = 2e-06
Identities = 30/31 (96%)
Strand = Plus / Minus
Query: 1338 catccttgaggacaaggatgttttgaagggg 1368
|||||||||||||||||||||||| ||||||
Sbjct: 255 catccttgaggacaaggatgttttcaagggg 225
>gnl|LJGI|TC81515
Length = 474
Score = 54.0 bits (27), Expect = 2e-06
Identities = 30/31 (96%)
Strand = Plus / Plus
Query: 1338 catccttgaggacaaggatgttttgaagggg 1368
|||||||||||||||||||||||| ||||||
Sbjct: 184 catccttgaggacaaggatgttttcaagggg 214