Miyakogusa Predicted Gene

Lj6g3v2273260.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v2273260.1 Non Chatacterized Hit- tr|C5X471|C5X471_SORBI
Putative uncharacterized protein Sb02g041770
OS=Sorghu,37.4,0.000000000000002,PIPK,Phosphatidylinositol-4-phosphate
5-kinase, core; Histone H3 K4-specific methyltransferase
SET7/,CUFF.60956.1
         (1359 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AV421861 similar to UniRef100_Q8RY89 Cluster: Phosphati...    78   2e-13
gnl|LJGI|TC72651 similar to UniRef100_A7QJD6 Cluster: Chromosome...    76   6e-13

>gnl|LJGI|AV421861 similar to UniRef100_Q8RY89 Cluster:
           Phosphatidylinositol-4-phosphate 5-kinase 8  (AtPIP5K8)
           (1-phosphatidylinositol-4-phosphate kinase 8)
           (PtdIns(4)P-5-kinase 8); n=1; Arabidopsis thaliana|Rep:
           Phosphatidylinositol-4-phosphate 5-kinase 8  (AtPIP5K8)
           (1-phosphatidylinositol-4-phosphate kinase 8)
           (PtdIns(4)P-5-kinase 8) - Arabidopsis thaliana
           (Mouse-ear cress), partial (4%)
          Length = 455

 Score = 77.8 bits (39), Expect = 2e-13
 Identities = 48/51 (94%)
 Strand = Plus / Plus

                                                              
Query: 81  ccatggcaagggaaagtacatatggtctgatggaacagtatatgagggtga 131
           |||||| ||||||||||||| |||||| |||||||||||||||||||||||
Sbjct: 405 ccatggaaagggaaagtacacatggtcagatggaacagtatatgagggtga 455


>gnl|LJGI|TC72651 similar to UniRef100_A7QJD6 Cluster: Chromosome chr8 scaffold_106,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr8 scaffold_106, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (56%)
          Length = 1529

 Score = 75.8 bits (38), Expect = 6e-13
 Identities = 74/86 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1219 tggaaggattattgccctatggtcttcaggaatttgagagagatgttcaggttagatgct 1278
            ||||| |||||||| || ||||| ||||| |||||||||||| |||||| | | ||||||
Sbjct: 846  tggaaagattattgtccaatggtgttcagaaatttgagagagttgttcaagattgatgct 905

                                      
Query: 1279 gcagagtacatgatgtccatttgtgg 1304
            || || || |||||||||||||||||
Sbjct: 906  gctgactatatgatgtccatttgtgg 931