Miyakogusa Predicted Gene

Lj6g3v2245600.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v2245600.1 Non Chatacterized Hit- tr|I1HQS0|I1HQS0_BRADI
Uncharacterized protein OS=Brachypodium distachyon
GN=,41.84,2e-19,CBS,Cystathionine beta-synthase, core; no
description,Aldolase-type TIM barrel; seg,NULL; Domain in
,CUFF.60965.1
         (420 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC81139                                                      143   1e-33

>gnl|LJGI|TC81139 
          Length = 518

 Score =  143 bits (72), Expect = 1e-33
 Identities = 93/100 (93%)
 Strand = Plus / Minus

                                                                       
Query: 263 aacttcgctttgcccaaatgattatgaaggaacatggagtcgatcaagttccagttgtga 322
           ||||||| | ||||||||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 516 aacttcgttatgcccaaatgattatgaaggaacatagagtcaatcaagttccagttgtga 457

                                                   
Query: 323 ggaatatctatgaaaaaacatatccagttggcatattgga 362
           | ||||||||||||| ||||||| ||||||||||||||||
Sbjct: 456 gaaatatctatgaaagaacatattcagttggcatattgga 417