Miyakogusa Predicted Gene

Lj6g3v2117930.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v2117930.2 Non Chatacterized Hit- tr|K4DB67|K4DB67_SOLLC
Uncharacterized protein OS=Solanum lycopersicum
GN=Sol,46.59,2e-19,PAN_2,PAN-2 domain; divergent subfamily of APPLE
domains,Apple-like; PAN,Apple-like; SUBFAMILY NOT N,CUFF.60677.2
         (312 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC59000 weakly similar to UniRef100_Q9S971 Cluster: ARK...    54   5e-07

>gnl|LJGI|TC59000 weakly similar to UniRef100_Q9S971 Cluster: ARK3
           product/receptor-like serine/threonine protein kinase
           ARK3; n=1; Arabidopsis thaliana|Rep: ARK3
           product/receptor-like serine/threonine protein kinase
           ARK3 - Arabidopsis thaliana (Mouse-ear cress), partial
           (28%)
          Length = 903

 Score = 54.0 bits (27), Expect = 5e-07
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 190 ggtggtcaagatctctatatcagaatagcagcttctgat 228
           ||||| |||||||||||| ||||| ||||||||||||||
Sbjct: 721 ggtgggcaagatctctatgtcagattagcagcttctgat 759