Miyakogusa Predicted Gene

Lj6g3v2095710.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v2095710.1 Non Chatacterized Hit- tr|I3SEP2|I3SEP2_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=2
SV=1,99.06,0,Homeodomain-like,Homeodomain-like; no
description,Homeodomain-like; HTH_MYB,Myb domain; MYB DNA
BIND,CUFF.60662.1
         (321 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO012149 similar to UniRef100_A7R2L2 Cluster: Chromosom...   636   0.0  
gnl|LJGI|BW614360 similar to UniRef100_Q6R077 Cluster: MYB trans...    78   4e-14
gnl|LJGI|TC62351 similar to UniRef100_Q0PJJ9 Cluster: MYB transc...    56   1e-07
gnl|LJGI|TC58498 similar to UniRef100_Q9XIU5 Cluster: GmMYB29B2 ...    54   5e-07
gnl|LJGI|FS343386 homologue to UniRef100_Q0PJK0 Cluster: MYB tra...    52   2e-06
gnl|LJGI|BW624444 homologue to UniRef100_A7PCT7 Cluster: Chromos...    52   2e-06
gnl|LJGI|TC78930 similar to UniRef100_Q0PJK0 Cluster: MYB transc...    52   2e-06
gnl|LJGI|TC67557 similar to UniRef100_Q0PJG9 Cluster: MYB transc...    50   8e-06

>gnl|LJGI|GO012149 similar to UniRef100_A7R2L2 Cluster: Chromosome undetermined
           scaffold_434, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome undetermined scaffold_434,
           whole genome shotgun sequence - Vitis vinifera (Grape),
           partial (47%)
          Length = 707

 Score =  636 bits (321), Expect = 0.0
 Identities = 321/321 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggggagaacaccttgttgtgaaaagaatggcctcaagaaagggccatggacttccgag 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 139 atggggagaacaccttgttgtgaaaagaatggcctcaagaaagggccatggacttccgag 198

                                                                       
Query: 61  gagaaccagaaactcattgattacattcagaaacatggatatggcaactggagaacactc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 199 gagaaccagaaactcattgattacattcagaaacatggatatggcaactggagaacactc 258

                                                                       
Query: 121 ccaaagaatgctgggctgcaaagatgtggaaagagttgccgtctccggtggacaaactat 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 259 ccaaagaatgctgggctgcaaagatgtggaaagagttgccgtctccggtggacaaactat 318

                                                                       
Query: 181 ctccggccagatataaagcgaggtcggttcacatttgaagaggaggagacaataattcag 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 319 ctccggccagatataaagcgaggtcggttcacatttgaagaggaggagacaataattcag 378

                                                                       
Query: 241 cttcatagcattcttggcaacaagtggtctgcaattgcatctcggttaccaggaagaaca 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 379 cttcatagcattcttggcaacaagtggtctgcaattgcatctcggttaccaggaagaaca 438

                                
Query: 301 gacaatgaaatcaagaactat 321
           |||||||||||||||||||||
Sbjct: 439 gacaatgaaatcaagaactat 459


>gnl|LJGI|BW614360 similar to UniRef100_Q6R077 Cluster: MYB transcription factor; n=1;
           Arabidopsis thaliana|Rep: MYB transcription factor -
           Arabidopsis thaliana (Mouse-ear cress), partial (36%)
          Length = 464

 Score = 77.8 bits (39), Expect = 4e-14
 Identities = 162/203 (79%)
 Strand = Plus / Plus

                                                                       
Query: 118 ctcccaaagaatgctgggctgcaaagatgtggaaagagttgccgtctccggtggacaaac 177
           |||||||| |||||||| |||||||||||||| ||||| || || || || |||||||| 
Sbjct: 230 ctcccaaaaaatgctggtctgcaaagatgtggcaagagctgtcgccttcgatggacaaat 289

                                                                       
Query: 178 tatctccggccagatataaagcgaggtcggttcacatttgaagaggaggagacaataatt 237
           || ||  |||| ||||| |   ||||  | ||  | |||||||| || ||||| || |||
Sbjct: 290 tacctgaggcctgatatcagaagaggaagattttcctttgaagaagaagagaccatcatt 349

                                                                       
Query: 238 cagcttcatagcattcttggcaacaagtggtctgcaattgcatctcggttaccaggaaga 297
           ||||| || ||  |  | || |||||||||||||| || ||  |||| || |||||||||
Sbjct: 350 cagctacacagtgtcttagggaacaagtggtctgctatagcggctcgattgccaggaaga 409

                                  
Query: 298 acagacaatgaaatcaagaacta 320
           |||||||||||||||||||||||
Sbjct: 410 acagacaatgaaatcaagaacta 432


>gnl|LJGI|TC62351 similar to UniRef100_Q0PJJ9 Cluster: MYB transcription factor
           MYB92; n=2; Glycine max|Rep: MYB transcription factor
           MYB92 - Glycine max (Soybean), partial (60%)
          Length = 1128

 Score = 56.0 bits (28), Expect = 1e-07
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 286 ttaccaggaagaacagacaatgaaatcaagaactat 321
           |||||||| ||||| |||||||||||||||||||||
Sbjct: 376 ttaccaggcagaaccgacaatgaaatcaagaactat 411


>gnl|LJGI|TC58498 similar to UniRef100_Q9XIU5 Cluster: GmMYB29B2 protein; n=1;
           Glycine max|Rep: GmMYB29B2 protein - Glycine max
           (Soybean), partial (81%)
          Length = 1373

 Score = 54.0 bits (27), Expect = 5e-07
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 253 cttggcaacaagtggtctgcaattgcatctcggttaccaggaagaacagacaatgaaat 311
           ||||| |||| |||||| ||||||||| |    ||||||||||||||||||||||||||
Sbjct: 391 cttgggaacaggtggtcagcaattgcagcaaaattaccaggaagaacagacaatgaaat 449


>gnl|LJGI|FS343386 homologue to UniRef100_Q0PJK0 Cluster: MYB transcription factor
           MYB88; n=1; Glycine max|Rep: MYB transcription factor
           MYB88 - Glycine max (Soybean), partial (52%)
          Length = 724

 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 286 ttaccaggaagaacagacaatgaaatcaagaact 319
           ||||||||| |||||||||||||||| |||||||
Sbjct: 673 ttaccaggacgaacagacaatgaaattaagaact 706


>gnl|LJGI|BW624444 homologue to UniRef100_A7PCT7 Cluster: Chromosome chr17
           scaffold_12, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr17 scaffold_12, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (19%)
          Length = 487

 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 130 gctgggctgcaaagatgtggaaagagttgc 159
           ||||| ||||||||||||||||||||||||
Sbjct: 408 gctggactgcaaagatgtggaaagagttgc 437


>gnl|LJGI|TC78930 similar to UniRef100_Q0PJK0 Cluster: MYB transcription factor
           MYB88; n=1; Glycine max|Rep: MYB transcription factor
           MYB88 - Glycine max (Soybean), partial (65%)
          Length = 922

 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 286 ttaccaggaagaacagacaatgaaatcaagaact 319
           ||||||||| |||||||||||||||| |||||||
Sbjct: 406 ttaccaggacgaacagacaatgaaattaagaact 439


>gnl|LJGI|TC67557 similar to UniRef100_Q0PJG9 Cluster: MYB transcription factor
           MYB115; n=1; Glycine max|Rep: MYB transcription factor
           MYB115 - Glycine max (Soybean), partial (58%)
          Length = 1115

 Score = 50.1 bits (25), Expect = 8e-06
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 296 gaacagacaatgaaatcaagaacta 320
           |||||||||||||||||||||||||
Sbjct: 293 gaacagacaatgaaatcaagaacta 317