Miyakogusa Predicted Gene

Lj6g3v2079220.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v2079220.1 tr|G7KVX4|G7KVX4_MEDTR Serpin-ZX OS=Medicago
truncatula GN=MTR_7g050810 PE=3 SV=1,56.67,0.0000000001,seg,NULL;
SERPIN,Protease inhibitor I4, serpin, conserved site; no
description,NULL; Serpins,Serpin ,CUFF.60628.1
         (543 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC66026 similar to UniRef100_Q2HSM8 Cluster: Proteinase...   143   1e-33
gnl|LJGI|TC69515 similar to UniRef100_Q0DQC3 Cluster: Os03g06107...   141   5e-33
gnl|LJGI|TC77428 similar to UniRef100_Q2HSM8 Cluster: Proteinase...   135   3e-31
gnl|LJGI|TC63404 similar to UniRef100_Q2HSM8 Cluster: Proteinase...   127   8e-29
gnl|LJGI|TC65588 weakly similar to UniRef100_Q44SB2 Cluster: Pro...   123   1e-27
gnl|LJGI|TC66682 similar to UniRef100_Q2HSM8 Cluster: Proteinase...   117   7e-26
gnl|LJGI|BP034134 similar to UniRef100_Q10GX1 Cluster: Serpin fa...   113   1e-24
gnl|LJGI|TC63990 similar to UniRef100_Q8GT65 Cluster: Serpin-lik...   111   5e-24
gnl|LJGI|BP041977 similar to UniRef100_Q2HSM8 Cluster: Proteinas...   105   3e-22
gnl|LJGI|TC79816 similar to UniRef100_A2Q2N0 Cluster: Proteinase...   101   4e-21
gnl|LJGI|TC66371 weakly similar to UniRef100_Q10GX1 Cluster: Ser...    98   7e-20
gnl|LJGI|BP073359 similar to UniRef100_Q8GT65 Cluster: Serpin-li...    78   6e-14
gnl|LJGI|AW428704 weakly similar to UniRef100_Q10GX1 Cluster: Se...    76   3e-13
gnl|LJGI|BP051691 similar to UniRef100_A2Q2N0 Cluster: Proteinas...    74   1e-12
gnl|LJGI|TC75793 similar to UniRef100_Q2HSM8 Cluster: Proteinase...    66   2e-10
gnl|LJGI|TC67954 similar to UniRef100_Q8GT65 Cluster: Serpin-lik...    62   4e-09
gnl|LJGI|TC80004 similar to UniRef100_Q8GT65 Cluster: Serpin-lik...    60   1e-08
gnl|LJGI|TC77786 similar to UniRef100_Q8GT65 Cluster: Serpin-lik...    60   1e-08

>gnl|LJGI|TC66026 similar to UniRef100_Q2HSM8 Cluster: Proteinase inhibitor I4, serpin;
            n=1; Medicago truncatula|Rep: Proteinase inhibitor I4,
            serpin - Medicago truncatula (Barrel medic), partial
            (35%)
          Length = 2267

 Score =  143 bits (72), Expect = 1e-33
 Identities = 93/100 (93%)
 Strand = Plus / Plus

                                                                        
Query: 366  tatagactttgtagctaaccaccctttcctcttcttgatcagagaagatttcaccggaac 425
            |||||||||| ||||| ||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 1165 tatagactttatagctgaccacccattcctcttcttgatcagagaagatttcaccggaac 1224

                                                    
Query: 426  agtcctcttcattggacaagtgctcaatcctcttgatgga 465
            | |||||||| |||| || |||||||||||||||||||||
Sbjct: 1225 aatcctcttcgttgggcaggtgctcaatcctcttgatgga 1264



 Score =  119 bits (60), Expect = 2e-26
 Identities = 168/204 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgtacatttttcttccagatgcaaaagatggattgtcaactttaattcaaaacttggct 60
           |||| |||||| |||||||||||| |||||||| | ||| ||||||||||||| ||| ||
Sbjct: 791 atgtgcattttccttccagatgcacaagatggactttcagctttaattcaaaagttgtct 850

                                                                       
Query: 61  tcagagtctggtttcttggaacaaacctttcctcgccgaaaacttccagtaggtcacttc 120
           |||||  || |||||||| ||   |   |||||||||||||| | | ||||  || ||||
Sbjct: 851 tcagaaccttgtttcttgaaaggcaagcttcctcgccgaaaagtacgagtacatcccttc 910

                                                                       
Query: 121 atgattccaaaattcaagatttcttatagtgttaaagctgctgatgtgctcaaggagctt 180
             ||||||||||||||| ||||||| ||   || ||||| || |||||||||||||| ||
Sbjct: 911 tggattccaaaattcaatatttcttttacatttgaagcttctaatgtgctcaaggaggtt 970

                                   
Query: 181 ggagttgtttcacctttctctcca 204
           ||||| ||||||||||||||||||
Sbjct: 971 ggagtggtttcacctttctctcca 994


>gnl|LJGI|TC69515 similar to UniRef100_Q0DQC3 Cluster: Os03g0610700 protein; n=2;
           Oryza sativa|Rep: Os03g0610700 protein - Oryza sativa
           subsp. japonica (Rice), partial (24%)
          Length = 700

 Score =  141 bits (71), Expect = 5e-33
 Identities = 98/107 (91%)
 Strand = Plus / Plus

                                                                       
Query: 362 ctggtatagactttgtagctaaccaccctttcctcttcttgatcagagaagatttcaccg 421
           ||||||||||||||   ||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 113 ctggtatagactttaacgctaaccaccctttcctcttcttgatcagagaagatttcacag 172

                                                          
Query: 422 gaacagtcctcttcattggacaagtgctcaatcctcttgatggagca 468
           ||||| |||||||| | || || ||||||||||||||||||||||||
Sbjct: 173 gaacaatcctcttcgtcgggcaggtgctcaatcctcttgatggagca 219



 Score = 67.9 bits (34), Expect = 6e-11
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                       
Query: 243 taaattacacgtggaaaccatatttcacaaagcattcattgaggtaaatgaacaagggac 302
           |||||||  |||||||| ||||||||||||||| |||||||| |||| |||| |||| ||
Sbjct: 3   taaattattcgtggaaagcatatttcacaaagctttcattgatgtaagtgaagaaggaac 62

                 
Query: 303 tgaagc 308
           ||||||
Sbjct: 63  tgaagc 68


>gnl|LJGI|TC77428 similar to UniRef100_Q2HSM8 Cluster: Proteinase inhibitor I4,
           serpin; n=1; Medicago truncatula|Rep: Proteinase
           inhibitor I4, serpin - Medicago truncatula (Barrel
           medic), partial (8%)
          Length = 399

 Score =  135 bits (68), Expect = 3e-31
 Identities = 104/116 (89%)
 Strand = Plus / Minus

                                                                       
Query: 358 ccagctggtatagactttgtagctaaccaccctttcctcttcttgatcagagaagatttc 417
           |||||||| ||||| |||||||| || ||||||||||||||||||||  ||||||| || 
Sbjct: 346 ccagctggcatagattttgtagcaaatcaccctttcctcttcttgatacgagaagaattg 287

                                                                   
Query: 418 accggaacagtcctcttcattggacaagtgctcaatcctcttgatggagcagaccc 473
           ||||||||| ||||||| ||||| || |||||||||||||||||||||||||||||
Sbjct: 286 accggaacattcctctttattgggcaggtgctcaatcctcttgatggagcagaccc 231


>gnl|LJGI|TC63404 similar to UniRef100_Q2HSM8 Cluster: Proteinase inhibitor I4, serpin;
            n=1; Medicago truncatula|Rep: Proteinase inhibitor I4,
            serpin - Medicago truncatula (Barrel medic), partial
            (39%)
          Length = 1719

 Score =  127 bits (64), Expect = 8e-29
 Identities = 94/104 (90%)
 Strand = Plus / Plus

                                                                        
Query: 366  tatagactttgtagctaaccaccctttcctcttcttgatcagagaagatttcaccggaac 425
            |||||| ||||||||  ||||||||||||||||||||||| |||||||| ||||||||||
Sbjct: 1180 tatagattttgtagcggaccaccctttcctcttcttgatccgagaagatatcaccggaac 1239

                                                        
Query: 426  agtcctcttcattggacaagtgctcaatcctcttgatggagcag 469
            | |||||||  |||| || |||||||||||||||||||||||||
Sbjct: 1240 aatcctctttgttgggcaggtgctcaatcctcttgatggagcag 1283



 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 1   atgtacatttttcttccagatgcaaaagatggattg 36
           |||||||||||||||||| ||| |||||||||||||
Sbjct: 816 atgtacatttttcttccaaatgaaaaagatggattg 851



 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 52/60 (86%)
 Strand = Plus / Plus

                                                                        
Query: 261  catatttcacaaagcattcattgaggtaaatgaacaagggactgaagctgcagcggccac 320
            ||||||||||||||| | |||||||||||||||| | |  |||| ||||| |||||||||
Sbjct: 1078 catatttcacaaagcttccattgaggtaaatgaagaggaaactgtagctgtagcggccac 1137


>gnl|LJGI|TC65588 weakly similar to UniRef100_Q44SB2 Cluster: Proteinase inhibitor
           I4, serpin precursor; n=1; Chlorobium limicola DSM
           245|Rep: Proteinase inhibitor I4, serpin precursor -
           Chlorobium limicola DSM 245, partial (13%)
          Length = 667

 Score =  123 bits (62), Expect = 1e-27
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 371 actttgtagctaaccaccctttcctcttcttgatcagagaagatttcaccggaacagtcc 430
           |||| |||||| ||||||| |||||||||||||||||||||||||||||||||||  | |
Sbjct: 198 acttcgtagctgaccaccccttcctcttcttgatcagagaagatttcaccggaaccatac 257

                                                 
Query: 431 tcttcattggacaagtgctcaatcctcttgatggagca 468
           ||||| |||| |||||||||||||||||||| ||||||
Sbjct: 258 tcttcgttgggcaagtgctcaatcctcttgaaggagca 295


>gnl|LJGI|TC66682 similar to UniRef100_Q2HSM8 Cluster: Proteinase inhibitor I4,
           serpin; n=1; Medicago truncatula|Rep: Proteinase
           inhibitor I4, serpin - Medicago truncatula (Barrel
           medic), partial (8%)
          Length = 631

 Score =  117 bits (59), Expect = 7e-26
 Identities = 101/115 (87%)
 Strand = Plus / Plus

                                                                       
Query: 355 attccagctggtatagactttgtagctaaccaccctttcctcttcttgatcagagaagat 414
           ||||| ||||||||||||||   |||| | |||||||||||||||||| |||||||||||
Sbjct: 25  attccggctggtatagacttcaaagctgagcaccctttcctcttcttggtcagagaagat 84

                                                                  
Query: 415 ttcaccggaacagtcctcttcattggacaagtgctcaatcctcttgatggagcag 469
           || || |||||| |||||||  |||| || |||||||||||||||||||||||||
Sbjct: 85  tttactggaacaatcctctttgttgggcaggtgctcaatcctcttgatggagcag 139


>gnl|LJGI|BP034134 similar to UniRef100_Q10GX1 Cluster: Serpin family protein,
           expressed; n=1; Oryza sativa Japonica Group|Rep: Serpin
           family protein, expressed - Oryza sativa subsp. japonica
           (Rice), partial (6%)
          Length = 556

 Score =  113 bits (57), Expect = 1e-24
 Identities = 78/85 (91%)
 Strand = Plus / Minus

                                                                       
Query: 385 caccctttcctcttcttgatcagagaagatttcaccggaacagtcctcttcattggacaa 444
           ||||||||||||||||||||| |||||||||| || |||||| ||||||| ||||| || 
Sbjct: 463 caccctttcctcttcttgatccgagaagatttgactggaacaatcctctttattgggcag 404

                                    
Query: 445 gtgctcaatcctcttgatggagcag 469
           |||||||||||||||||||||||||
Sbjct: 403 gtgctcaatcctcttgatggagcag 379


>gnl|LJGI|TC63990 similar to UniRef100_Q8GT65 Cluster: Serpin-like protein; n=1;
           Citrus x paradisi|Rep: Serpin-like protein - Citrus
           paradisi (Grapefruit), partial (16%)
          Length = 831

 Score =  111 bits (56), Expect = 5e-24
 Identities = 86/96 (89%)
 Strand = Plus / Plus

                                                                       
Query: 361 gctggtatagactttgtagctaaccaccctttcctcttcttgatcagagaagatttcacc 420
           ||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| || 
Sbjct: 404 gctggtatagactttgtagctgaccaccctttcttcttcttgatcagagaagattttact 463

                                               
Query: 421 ggaacagtcctcttcattggacaagtgctcaatcct 456
           |||||| | ||||| ||||| || |||||| |||||
Sbjct: 464 ggaacaattctctttattgggcaggtgctccatcct 499



 Score = 93.7 bits (47), Expect = 1e-18
 Identities = 188/235 (80%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgtacatttttcttccagatgcaaaagatggattgtcaactttaattcaaaacttggct 60
           ||||||||||| ||||| ||||||||| |||||||| || |||||||| |||  ||||||
Sbjct: 32  atgtacattttccttccggatgcaaaaaatggattgccagctttaattgaaaggttggct 91

                                                                       
Query: 61  tcagagtctggtttcttggaacaaacctttcctcgccgaaaacttccagtaggtcacttc 120
           ||||| |||||||||||| ||   |  |||||||| ||||||    || || | ||||||
Sbjct: 92  tcagaatctggtttcttgaaaggcaagtttcctcggcgaaaagcggcaataagacacttc 151

                                                                       
Query: 121 atgattccaaaattcaagatttcttatagtgttaaagctgctgatgtgctcaaggagctt 180
           | ||||||||||||| | ||||||| |    || ||||| || ||||||| | |||| | 
Sbjct: 152 aggattccaaaattcgatatttcttttgaacttgaagcttctcatgtgctgatggagtta 211

                                                                  
Query: 181 ggagttgtttcacctttctctccacaggatgccgatttttcaaaaatgctggagg 235
           ||||| ||||| ||||||||| ||   ||||| |||||| |||||||| ||||||
Sbjct: 212 ggagtggtttcgcctttctcttcaactgatgcagattttacaaaaatggtggagg 266



 Score = 61.9 bits (31), Expect = 4e-09
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 263 tatttcacaaagcattcattgaggtaaatgaacaagggactgaagctgcagcggccact 321
           ||||||||||||| |||||| ||||| ||||| |||| |||  ||||||||||||||||
Sbjct: 306 tatttcacaaagctttcattaaggtagatgaagaaggtactacagctgcagcggccact 364


>gnl|LJGI|BP041977 similar to UniRef100_Q2HSM8 Cluster: Proteinase inhibitor I4,
           serpin; n=1; Medicago truncatula|Rep: Proteinase
           inhibitor I4, serpin - Medicago truncatula (Barrel
           medic), partial (8%)
          Length = 571

 Score =  105 bits (53), Expect = 3e-22
 Identities = 91/104 (87%)
 Strand = Plus / Minus

                                                                       
Query: 366 tatagactttgtagctaaccaccctttcctcttcttgatcagagaagatttcaccggaac 425
           |||||| ||||||||  |||||||||||||||| ||| || |||||||| ||||||||||
Sbjct: 567 tatagattttgtagcggaccaccctttcctcttgttggtccgagaagatatcaccggaac 508

                                                       
Query: 426 agtcctcttcattggacaagtgctcaatcctcttgatggagcag 469
           | |||||||  |||| || |||||| ||||||||||||||||||
Sbjct: 507 aatcctctttgttgggcaggtgctcnatcctcttgatggagcag 464


>gnl|LJGI|TC79816 similar to UniRef100_A2Q2N0 Cluster: Proteinase inhibitor I4,
           serpin; n=1; Medicago truncatula|Rep: Proteinase
           inhibitor I4, serpin - Medicago truncatula (Barrel
           medic), partial (9%)
          Length = 401

 Score =  101 bits (51), Expect = 4e-21
 Identities = 78/87 (89%)
 Strand = Plus / Plus

                                                                       
Query: 371 actttgtagctaaccaccctttcctcttcttgatcagagaagatttcaccggaacagtcc 430
           ||||||||||| ||||||||||||||||||| ||| |||||||||||||||||||| |||
Sbjct: 3   actttgtagctgaccaccctttcctcttcttaatccgagaagatttcaccggaacaatcc 62

                                      
Query: 431 tcttcattggacaagtgctcaatcctc 457
           | |||||||| || || ||| ||||||
Sbjct: 63  ttttcattgggcaggttctccatcctc 89


>gnl|LJGI|TC66371 weakly similar to UniRef100_Q10GX1 Cluster: Serpin family protein,
            expressed; n=1; Oryza sativa Japonica Group|Rep: Serpin
            family protein, expressed - Oryza sativa subsp. japonica
            (Rice), partial (22%)
          Length = 1681

 Score = 97.6 bits (49), Expect = 7e-20
 Identities = 88/101 (87%)
 Strand = Plus / Plus

                                                                        
Query: 368  tagactttgtagctaaccaccctttcctcttcttgatcagagaagatttcaccggaacag 427
            |||| ||| ||||| | ||||||||||||||||||||||||||||||||| | |||||| 
Sbjct: 1126 tagaatttatagctgatcaccctttcctcttcttgatcagagaagatttctctggaacaa 1185

                                                     
Query: 428  tcctcttcattggacaagtgctcaatcctcttgatggagca 468
            |||||||  |||| || |||||||| ||||||| |||||||
Sbjct: 1186 tcctctttgttgggcaggtgctcaaccctcttggtggagca 1226



 Score = 81.8 bits (41), Expect = 4e-15
 Identities = 62/69 (89%)
 Strand = Plus / Plus

                                                                        
Query: 252  cgtggaaaccatatttcacaaagcattcattgaggtaaatgaacaagggactgaagctgc 311
            |||||||| ||||||||| ||||  |||||| ||||||| ||||||||||||||||||||
Sbjct: 1013 cgtggaaagcatatttcaaaaagttttcattaaggtaaacgaacaagggactgaagctgc 1072

                     
Query: 312  agcggccac 320
             ||||||||
Sbjct: 1073 ggcggccac 1081


>gnl|LJGI|BP073359 similar to UniRef100_Q8GT65 Cluster: Serpin-like protein; n=1;
           Citrus x paradisi|Rep: Serpin-like protein - Citrus
           paradisi (Grapefruit), partial (9%)
          Length = 388

 Score = 77.8 bits (39), Expect = 6e-14
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 369 agactttgtagctaaccaccctttcctcttcttgatcagagaagatttcaccggaacagt 428
           ||||||||||||| |||||||||| |||||||| |||| ||||||| | | ||||||| |
Sbjct: 318 agactttgtagctgaccacccttttctcttcttaatcaaagaagatctgagcggaacaat 259

                                      
Query: 429 cctcttcattggacaagtgctcaatcc 455
           |||||| |||||||  |||||| ||||
Sbjct: 258 cctctttattggacgggtgctccatcc 232


>gnl|LJGI|AW428704 weakly similar to UniRef100_Q10GX1 Cluster: Serpin family protein,
           expressed; n=1; Oryza sativa Japonica Group|Rep: Serpin
           family protein, expressed - Oryza sativa subsp. japonica
           (Rice), partial (8%)
          Length = 355

 Score = 75.8 bits (38), Expect = 3e-13
 Identities = 59/66 (89%)
 Strand = Plus / Plus

                                                                       
Query: 252 cgtggaaaccatatttcacaaagcattcattgaggtaaatgaacaagggactgaagctgc 311
           |||||||| ||||||||| ||||  |||||| ||||||| ||||||||||||||||||||
Sbjct: 265 cgtggaaagcatatttcaaaaagttttcattaaggtaaacgaacaagggactgaagctgc 324

                 
Query: 312 agcggc 317
            |||||
Sbjct: 325 ggcggc 330


>gnl|LJGI|BP051691 similar to UniRef100_A2Q2N0 Cluster: Proteinase inhibitor I4,
           serpin; n=1; Medicago truncatula|Rep: Proteinase
           inhibitor I4, serpin - Medicago truncatula (Barrel
           medic), partial (13%)
          Length = 428

 Score = 73.8 bits (37), Expect = 1e-12
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                
Query: 265 tttcacaaagcattcattgaggtaaatgaacaagggactgaagctgcagcggc 317
           ||||| ||||| |||||||||||||||||| |||| |||||||||||||||||
Sbjct: 343 tttcataaagctttcattgaggtaaatgaagaaggaactgaagctgcagcggc 291


>gnl|LJGI|TC75793 similar to UniRef100_Q2HSM8 Cluster: Proteinase inhibitor I4,
           serpin; n=1; Medicago truncatula|Rep: Proteinase
           inhibitor I4, serpin - Medicago truncatula (Barrel
           medic), partial (35%)
          Length = 722

 Score = 65.9 bits (33), Expect = 2e-10
 Identities = 81/97 (83%)
 Strand = Plus / Plus

                                                                       
Query: 368 tagactttgtagctaaccaccctttcctcttcttgatcagagaagatttcaccggaacag 427
           ||||||| |||||| |||| |||||| | ||| ||||||||||||||||  | |||||| 
Sbjct: 414 tagacttcgtagctgaccatcctttcatgttcctgatcagagaagatttgtctggaacaa 473

                                                
Query: 428 tcctcttcattggacaagtgctcaatcctcttgatgg 464
           | || || ||||| || ||||||||||| ||||||||
Sbjct: 474 tactatttattgggcaggtgctcaatccacttgatgg 510



 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 263 tatttcacaaagcattcattgaggtaaatgaacaagggactgaagctgcagc 314
           ||||||||||  | |||||||| ||||||||| |||| ||||||||||||||
Sbjct: 309 tatttcacaagtctttcattgaagtaaatgaagaaggcactgaagctgcagc 360


>gnl|LJGI|TC67954 similar to UniRef100_Q8GT65 Cluster: Serpin-like protein; n=1;
           Citrus x paradisi|Rep: Serpin-like protein - Citrus
           paradisi (Grapefruit), partial (31%)
          Length = 781

 Score = 61.9 bits (31), Expect = 4e-09
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 261 catatttcacaaagcattcattgaggtaaatgaacaagggactgaagctgcagcggcca 319
           ||||||||||||  | |||||||| ||||||||| |||| |||||||||||||| ||||
Sbjct: 228 catatttcacaagtctttcattgaagtaaatgaagaaggcactgaagctgcagcagcca 286



 Score = 58.0 bits (29), Expect = 6e-08
 Identities = 71/85 (83%)
 Strand = Plus / Plus

                                                                       
Query: 376 gtagctaaccaccctttcctcttcttgatcagagaagatttcaccggaacagtcctcttc 435
           |||||| ||||||| ||| | ||| |||||||||||||||| ||||||||||| || || 
Sbjct: 340 gtagctgaccaccccttcttgttcgtgatcagagaagatttgaccggaacagtactattt 399

                                    
Query: 436 attggacaagtgctcaatcctcttg 460
           |  || || ||||||||||| ||||
Sbjct: 400 acagggcaggtgctcaatccacttg 424


>gnl|LJGI|TC80004 similar to UniRef100_Q8GT65 Cluster: Serpin-like protein; n=1;
           Citrus x paradisi|Rep: Serpin-like protein - Citrus
           paradisi (Grapefruit), partial (76%)
          Length = 1537

 Score = 60.0 bits (30), Expect = 1e-08
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 1   atgtacatttttcttccagatgcaaaagatggattgtc 38
           |||||||||||||||||| ||||||||||||| |||||
Sbjct: 877 atgtacatttttcttccaaatgcaaaagatgggttgtc 914


>gnl|LJGI|TC77786 similar to UniRef100_Q8GT65 Cluster: Serpin-like protein; n=1;
           Citrus x paradisi|Rep: Serpin-like protein - Citrus
           paradisi (Grapefruit), partial (70%)
          Length = 1367

 Score = 60.0 bits (30), Expect = 1e-08
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 1   atgtacatttttcttccagatgcaaaagatggattgtc 38
           |||||||||||||||||| ||||||||||||| |||||
Sbjct: 700 atgtacatttttcttccaaatgcaaaagatgggttgtc 737