Miyakogusa Predicted Gene
- Lj6g3v2043200.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj6g3v2043200.1 Non Chatacterized Hit- tr|I3T0X1|I3T0X1_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=2
SV=1,100,0,zf-C3HC4_3,NULL; no description,Zinc finger,
RING/FYVE/PHD-type; ZF_RING_1,Zinc finger, RING-type, c,CUFF.60569.1
(759 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC57224 homologue to UniRef100_A2Q4Q8 Cluster: Zinc fin... 1405 0.0
gnl|LJGI|TC76343 homologue to UniRef100_A2Q4Q8 Cluster: Zinc fin... 309 1e-83
gnl|LJGI|BP074755 homologue to UniRef100_A7R6M1 Cluster: Chromos... 119 3e-26
gnl|LJGI|BW597024 similar to UniRef100_Q8GTX9 Cluster: Cell cycl... 109 3e-23
gnl|LJGI|GO009898 similar to UniRef100_Q9LLM2 Cluster: MTD2; n=1... 52 5e-06
gnl|LJGI|GO032499 similar to UniRef100_Q9LLM2 Cluster: MTD2; n=1... 52 5e-06
gnl|LJGI|TC60693 similar to UniRef100_Q9LLM2 Cluster: MTD2; n=1;... 52 5e-06
>gnl|LJGI|TC57224 homologue to UniRef100_A2Q4Q8 Cluster: Zinc finger, RING-type; n=1;
Medicago truncatula|Rep: Zinc finger, RING-type -
Medicago truncatula (Barrel medic), partial (98%)
Length = 1239
Score = 1405 bits (709), Expect = 0.0
Identities = 723/730 (99%)
Strand = Plus / Plus
Query: 30 catgggaaggtctttcaaggaatccctcaaacttcttgaagctgatatccaccatgccaa 89
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 169 catgggaaggtctttcaaggaatccctcaaacttcttgaagctgatatccaccatgccaa 228
Query: 90 taccctggcctcggattttccgagggaatatgatggtgcgtgccttcagatgagaatgtc 149
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 229 taccctggcctcggattttccgagggaatatgatggtgcgtgccttcagatgagaatgtc 288
Query: 150 atacagtccagcagcacgcctgtttcnnnnnnnggtgcaatggacagactgcaatcttgc 209
|||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 289 atacagtccagcagcacgcctgtttctttttttggtgcaatggacagactgcaatcttgc 348
Query: 210 cggagctcttggactgttgagaatcctaatttacaaggtgtatgtggacgggacaactac 269
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 349 cggagctcttggactgttgagaatcctaatttacaaggtgtatgtggacgggacaactac 408
Query: 270 catgtctgtccatgaaagaaaagcaagtattagggaattctatgggttcatatatccctc 329
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 409 catgtctgtccatgaaagaaaagcaagtattagggaattctatgggttcatatatccctc 468
Query: 330 tttattgcaacttcaaaagggtgtcactgatacagaggataaaaaacagaaggctgtttg 389
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 469 tttattgcaacttcaaaagggtgtcactgatacagaggataaaaaacagaaggctgtttg 528
Query: 390 catggaaaggtatcgaagaagagatgatgaggaggatagacagtcttcagacatagacat 449
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 529 catggaaaggtatcgaagaagagatgatgaggaggatagacagtcttcagacatagacat 588
Query: 450 tgaaagagaagaagaatgtggaatatgcatggaaatgaatagtaagattgttttgccaga 509
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 589 tgaaagagaagaagaatgtggaatatgcatggaaatgaatagtaagattgttttgccaga 648
Query: 510 ctgcaaccacgccatgtgcctgaaatgttaccatgaatggagaacaagatcacagtcatg 569
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 649 ctgcaaccacgccatgtgcctgaaatgttaccatgaatggagaacaagatcacagtcatg 708
Query: 570 ccccttttgccgagacagtcttgagagtgtgaactcaggtgatctgtgggtattaactga 629
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 709 ccccttttgccgagacagtcttgagagtgtgaactcaggtgatctgtgggtattaactga 768
Query: 630 tagtagggatgtggtagacatggcaacagtgacaagggagaatattagaagacttttcat 689
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 769 tagtagggatgtggtagacatggcaacagtgacaagggagaatattagaagacttttcat 828
Query: 690 gtacatagataagttgcctctgatcattccagattccctttttgatacatatgactctca 749
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 829 gtacatagataagttgcctctgatcattccagattccctttttgatacatatgactctca 888
Query: 750 cctaagataa 759
||||||||||
Sbjct: 889 cctaagataa 898
>gnl|LJGI|TC76343 homologue to UniRef100_A2Q4Q8 Cluster: Zinc finger, RING-type; n=1;
Medicago truncatula|Rep: Zinc finger, RING-type -
Medicago truncatula (Barrel medic), partial (46%)
Length = 546
Score = 309 bits (156), Expect = 1e-83
Identities = 272/313 (86%)
Strand = Plus / Plus
Query: 58 aaacttcttgaagctgatatccaccatgccaataccctggcctcggattttccgagggaa 117
||||| |||||||||||||| ||||||||||||||||||||||| |||||||| ||||||
Sbjct: 227 aaactccttgaagctgatattcaccatgccaataccctggcctcagattttcctagggaa 286
Query: 118 tatgatggtgcgtgccttcagatgagaatgtcatacagtccagcagcacgcctgtttcnn 177
|||||||| || |||||||||||||||||||||||||||||||| |||| ||||||||
Sbjct: 287 tatgatggagcatgccttcagatgagaatgtcatacagtccagctgcacacctgtttctt 346
Query: 178 nnnnnggtgcaatggacagactgcaatcttgccggagctcttggactgttgagaatccta 237
|||||| |||||||| || | ||||| || || |||||| ||||||||||||||
Sbjct: 347 tttctggtgcagtggacagattgtcaccttgctggggcccttggattgttgagaatccta 406
Query: 238 atttacaaggtgtatgtggacgggacaactaccatgtctgtccatgaaagaaaagcaagt 297
|||||||||||||||||||| |||||||| ||||||||| |||||||||||||||||
Sbjct: 407 atttacaaggtgtatgtggatgggacaaccaccatgtctactcatgaaagaaaagcaagc 466
Query: 298 attagggaattctatgggttcatatatccctctttattgcaacttcaaaagggtgtcact 357
||||| |||||||||| | |||| ||||||||| | ||||||||||| || || || |||
Sbjct: 467 attagagaattctatgcggtcatttatccctctctgttgcaacttcagaaaggcgttact 526
Query: 358 gatacagaggata 370
||||| |||||||
Sbjct: 527 gatactgaggata 539
>gnl|LJGI|BP074755 homologue to UniRef100_A7R6M1 Cluster: Chromosome undetermined
scaffold_1336, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome undetermined scaffold_1336,
whole genome shotgun sequence - Vitis vinifera (Grape),
partial (25%)
Length = 445
Score = 119 bits (60), Expect = 3e-26
Identities = 60/60 (100%)
Strand = Plus / Minus
Query: 700 aagttgcctctgatcattccagattccctttttgatacatatgactctcacctaagataa 759
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 445 aagttgcctctgatcattccagattccctttttgatacatatgactctcacctaagataa 386
>gnl|LJGI|BW597024 similar to UniRef100_Q8GTX9 Cluster: Cell cycle control crn
(Crooked neck) protein-like; n=1; Arabidopsis
thaliana|Rep: Cell cycle control crn (Crooked neck)
protein-like - Arabidopsis thaliana (Mouse-ear cress),
partial (6%)
Length = 483
Score = 109 bits (55), Expect = 3e-23
Identities = 64/67 (95%)
Strand = Plus / Plus
Query: 30 catgggaaggtctttcaaggaatccctcaaacttcttgaagctgatatccaccatgccaa 89
||||||||||||||||||||||||||| ||||| ||||||| ||||||||||||||||||
Sbjct: 78 catgggaaggtctttcaaggaatcccttaaactgcttgaagttgatatccaccatgccaa 137
Query: 90 taccctg 96
|||||||
Sbjct: 138 taccctg 144
>gnl|LJGI|GO009898 similar to UniRef100_Q9LLM2 Cluster: MTD2; n=1; Medicago
truncatula|Rep: MTD2 - Medicago truncatula (Barrel
medic), partial (51%)
Length = 710
Score = 52.0 bits (26), Expect = 5e-06
Identities = 77/94 (81%)
Strand = Plus / Plus
Query: 67 gaagctgatatccaccatgccaataccctggcctcggattttccgagggaatatgatggt 126
||||||||||| || |||| ||||||||||| | |||| ||| |||||| |||||||
Sbjct: 207 gaagctgatattcagtatgcaaataccctggcattggatcatccaagggaaaatgatgga 266
Query: 127 gcgtgccttcagatgagaatgtcatacagtccag 160
| ||| |||||||||| |||| ||||||||||
Sbjct: 267 ggatgctttcagatgaggctgtcttacagtccag 300
>gnl|LJGI|GO032499 similar to UniRef100_Q9LLM2 Cluster: MTD2; n=1; Medicago
truncatula|Rep: MTD2 - Medicago truncatula (Barrel
medic), partial (74%)
Length = 707
Score = 52.0 bits (26), Expect = 5e-06
Identities = 77/94 (81%)
Strand = Plus / Plus
Query: 67 gaagctgatatccaccatgccaataccctggcctcggattttccgagggaatatgatggt 126
||||||||||| || |||| ||||||||||| | |||| ||| |||||| |||||||
Sbjct: 198 gaagctgatattcagtatgcaaataccctggcattggatcatccaagggaaaatgatgga 257
Query: 127 gcgtgccttcagatgagaatgtcatacagtccag 160
| ||| |||||||||| |||| ||||||||||
Sbjct: 258 ggatgctttcagatgaggctgtcttacagtccag 291
>gnl|LJGI|TC60693 similar to UniRef100_Q9LLM2 Cluster: MTD2; n=1; Medicago
truncatula|Rep: MTD2 - Medicago truncatula (Barrel
medic), complete
Length = 905
Score = 52.0 bits (26), Expect = 5e-06
Identities = 77/94 (81%)
Strand = Plus / Plus
Query: 67 gaagctgatatccaccatgccaataccctggcctcggattttccgagggaatatgatggt 126
||||||||||| || |||| ||||||||||| | |||| ||| |||||| |||||||
Sbjct: 94 gaagctgatattcagtatgcaaataccctggcattggatcatccaagggaaaatgatgga 153
Query: 127 gcgtgccttcagatgagaatgtcatacagtccag 160
| ||| |||||||||| |||| ||||||||||
Sbjct: 154 ggatgctttcagatgaggctgtcttacagtccag 187