Miyakogusa Predicted Gene
- Lj6g3v2017500.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj6g3v2017500.1 Non Chatacterized Hit- tr|I1M221|I1M221_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,46.75,0,SUBFAMILY NOT
NAMED,NULL; FAMILY NOT NAMED,NULL; Q9SSY7_PEA_Q9SSY7;,Zinc finger,
Dof-type; seg,NULL;,CUFF.61061.1
(954 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC66125 similar to UniRef100_Q0GLD5 Cluster: Dof17; n=1... 94 2e-18
gnl|LJGI|TC79148 homologue to UniRef100_Q0GLD5 Cluster: Dof17; n... 76 4e-13
gnl|LJGI|TC61491 similar to UniRef100_Q0GLD5 Cluster: Dof17; n=1... 76 4e-13
gnl|LJGI|FS336172 similar to UniRef100_Q0GLE5 Cluster: Dof7; n=1... 72 7e-12
gnl|LJGI|TC75151 similar to UniRef100_Q0GLC9 Cluster: Dof22; n=1... 70 3e-11
gnl|LJGI|TC59564 similar to UniRef100_Q76KV2 Cluster: DNA bindin... 68 1e-10
gnl|LJGI|DC599154 homologue to UniRef100_A7QPU1 Cluster: Chromos... 66 4e-10
gnl|LJGI|TC59646 similar to UniRef100_Q0GLE2 Cluster: Dof10; n=1... 62 7e-09
gnl|LJGI|AW720051 similar to UniRef100_Q0GLE8 Cluster: Dof4; n=1... 58 1e-07
gnl|LJGI|BP069051 similar to UniRef100_Q0GLD3 Cluster: Dof19; n=... 58 1e-07
gnl|LJGI|DC599444 homologue to UniRef100_Q0GLD5 Cluster: Dof17; ... 52 6e-06
gnl|LJGI|TC72546 similar to UniRef100_Q76KU9 Cluster: DNA bindin... 52 6e-06
>gnl|LJGI|TC66125 similar to UniRef100_Q0GLD5 Cluster: Dof17; n=1; Glycine max|Rep:
Dof17 - Glycine max (Soybean), partial (68%)
Length = 1682
Score = 93.7 bits (47), Expect = 2e-18
Identities = 104/123 (84%)
Strand = Plus / Plus
Query: 130 aacacaaagttctgttactacaacaactacagcttgacacagcctcgttacttttgcaag 189
||||| |||||||| |||||||||||||||||| | ||||| ||| | ||||| ||||||
Sbjct: 769 aacaccaagttctgctactacaacaactacagcctcacacaacctagatacttctgcaag 828
Query: 190 acatgcagaaggtactggacccaaggtggggccctcaggaacgttcctgttggcggtggt 249
||||| |||||||||||||| |||||||| | ||||| || || || || || ||||||
Sbjct: 829 acatgtagaaggtactggacagaaggtgggtctctcagaaatgtcccagtaggaggtggt 888
Query: 250 tcc 252
|||
Sbjct: 889 tcc 891
>gnl|LJGI|TC79148 homologue to UniRef100_Q0GLD5 Cluster: Dof17; n=1; Glycine max|Rep:
Dof17 - Glycine max (Soybean), partial (32%)
Length = 813
Score = 75.8 bits (38), Expect = 4e-13
Identities = 101/122 (82%)
Strand = Plus / Plus
Query: 130 aacacaaagttctgttactacaacaactacagcttgacacagcctcgttacttttgcaag 189
||||| |||||||| || ||||||||||||||| | ||||| || | ||||| ||||||
Sbjct: 418 aacaccaagttctgctattacaacaactacagcctcacacaaccgagatacttctgcaag 477
Query: 190 acatgcagaaggtactggacccaaggtggggccctcaggaacgttcctgttggcggtggt 249
|||||||||||||| ||||| |||| ||| | ||||| || || || ||||| ||||||
Sbjct: 478 acatgcagaaggtattggacagaaggagggtctctcagaaatgtcccagttggaggtggt 537
Query: 250 tc 251
||
Sbjct: 538 tc 539
>gnl|LJGI|TC61491 similar to UniRef100_Q0GLD5 Cluster: Dof17; n=1; Glycine max|Rep:
Dof17 - Glycine max (Soybean), partial (46%)
Length = 1290
Score = 75.8 bits (38), Expect = 4e-13
Identities = 101/122 (82%)
Strand = Plus / Plus
Query: 130 aacacaaagttctgttactacaacaactacagcttgacacagcctcgttacttttgcaag 189
||||| |||||||| || ||||||||||||||| | ||||| || | ||||| ||||||
Sbjct: 206 aacaccaagttctgctattacaacaactacagcctcacacaaccgagatacttctgcaag 265
Query: 190 acatgcagaaggtactggacccaaggtggggccctcaggaacgttcctgttggcggtggt 249
|||||||||||||| ||||| |||| ||| | ||||| || || || ||||| ||||||
Sbjct: 266 acatgcagaaggtattggacagaaggagggtctctcagaaatgtcccagttggaggtggt 325
Query: 250 tc 251
||
Sbjct: 326 tc 327
>gnl|LJGI|FS336172 similar to UniRef100_Q0GLE5 Cluster: Dof7; n=1; Glycine max|Rep:
Dof7 - Glycine max (Soybean), partial (75%)
Length = 765
Score = 71.9 bits (36), Expect = 7e-12
Identities = 87/104 (83%)
Strand = Plus / Plus
Query: 112 cctcgctgtgactccatgaacacaaagttctgttactacaacaactacagcttgacacag 171
||||| || |||||| |||||| |||||||| |||||||||||||||| | | || |||
Sbjct: 172 cctcgatgcgactcctcgaacaccaagttctgctactacaacaactacaacctcactcag 231
Query: 172 cctcgttacttttgcaagacatgcagaaggtactggacccaagg 215
||||| |||| |||||||||||| | ||||||||||| ||||
Sbjct: 232 cctcgccacttctgcaagacatgccgccggtactggaccaaagg 275
>gnl|LJGI|TC75151 similar to UniRef100_Q0GLC9 Cluster: Dof22; n=1; Glycine max|Rep:
Dof22 - Glycine max (Soybean), partial (31%)
Length = 786
Score = 69.9 bits (35), Expect = 3e-11
Identities = 50/55 (90%)
Strand = Plus / Plus
Query: 106 aagtgtcctcgctgtgactccatgaacacaaagttctgttactacaacaactaca 160
||||| || |||||||||||||| ||||| |||||||| ||||||||||||||||
Sbjct: 477 aagtgcccccgctgtgactccatcaacaccaagttctgctactacaacaactaca 531
>gnl|LJGI|TC59564 similar to UniRef100_Q76KV2 Cluster: DNA binding with one finger 2
protein; n=1; Pisum sativum|Rep: DNA binding with one
finger 2 protein - Pisum sativum (Garden pea), partial
(69%)
Length = 1515
Score = 67.9 bits (34), Expect = 1e-10
Identities = 82/98 (83%)
Strand = Plus / Plus
Query: 118 tgtgactccatgaacacaaagttctgttactacaacaactacagcttgacacagcctcgt 177
|||||||||| ||||| || |||||||||||||||||||||||| | | |||||| |
Sbjct: 539 tgtgactccagcaacaccaaattctgttactacaacaactacagcctctcccagcctaga 598
Query: 178 tacttttgcaagacatgcagaaggtactggacccaagg 215
||||| |||||| | ||||| || ||||||||| ||||
Sbjct: 599 tacttctgcaagtcttgcaggagatactggaccaaagg 636
>gnl|LJGI|DC599154 homologue to UniRef100_A7QPU1 Cluster: Chromosome chr10
scaffold_138, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome chr10 scaffold_138, whole
genome shotgun sequence - Vitis vinifera (Grape),
partial (23%)
Length = 559
Score = 65.9 bits (33), Expect = 4e-10
Identities = 102/125 (81%)
Strand = Plus / Plus
Query: 112 cctcgctgtgactccatgaacacaaagttctgttactacaacaactacagcttgacacag 171
|||||||||||||| | ||||| || ||||| ||||||||||||||||| ||| |||||
Sbjct: 95 cctcgctgtgactcaaccaacaccaaattctgctactacaacaactacagtttgtcacag 154
Query: 172 cctcgttacttttgcaagacatgcagaaggtactggacccaaggtggggccctcaggaac 231
|| | |||||||||| | |||| || |||||||| | ||||||| | ||||| |||
Sbjct: 155 ccaagacacttttgcaaagcttgcaagagatactggactcgaggtgggactctcagaaac 214
Query: 232 gttcc 236
|||||
Sbjct: 215 gttcc 219
>gnl|LJGI|TC59646 similar to UniRef100_Q0GLE2 Cluster: Dof10; n=1; Glycine max|Rep:
Dof10 - Glycine max (Soybean), partial (69%)
Length = 1723
Score = 61.9 bits (31), Expect = 7e-09
Identities = 40/43 (93%)
Strand = Plus / Plus
Query: 118 tgtgactccatgaacacaaagttctgttactacaacaactaca 160
||||||||||| ||||| |||||||| ||||||||||||||||
Sbjct: 298 tgtgactccatcaacaccaagttctgctactacaacaactaca 340
>gnl|LJGI|AW720051 similar to UniRef100_Q0GLE8 Cluster: Dof4; n=1; Glycine max|Rep:
Dof4 - Glycine max (Soybean), partial (24%)
Length = 564
Score = 58.0 bits (29), Expect = 1e-07
Identities = 44/49 (89%)
Strand = Plus / Plus
Query: 112 cctcgctgtgactccatgaacacaaagttctgttactacaacaactaca 160
||||||||||| || ||||||| |||||||| ||||||||||||||||
Sbjct: 145 cctcgctgtgagtcactgaacaccaagttctgctactacaacaactaca 193
>gnl|LJGI|BP069051 similar to UniRef100_Q0GLD3 Cluster: Dof19; n=1; Glycine max|Rep:
Dof19 - Glycine max (Soybean), partial (44%)
Length = 344
Score = 58.0 bits (29), Expect = 1e-07
Identities = 62/73 (84%)
Strand = Plus / Minus
Query: 137 agttctgttactacaacaactacagcttgacacagcctcgttacttttgcaagacatgca 196
||||||| |||||||||||||| ||| | || ||||| | ||||| ||| |||| ||||
Sbjct: 261 agttctgctactacaacaactatagcctcactcagcccaggtacttctgctagacttgca 202
Query: 197 gaaggtactggac 209
|||||||||||||
Sbjct: 201 gaaggtactggac 189
>gnl|LJGI|DC599444 homologue to UniRef100_Q0GLD5 Cluster: Dof17; n=1; Glycine max|Rep:
Dof17 - Glycine max (Soybean), partial (15%)
Length = 463
Score = 52.0 bits (26), Expect = 6e-06
Identities = 50/58 (86%)
Strand = Plus / Plus
Query: 130 aacacaaagttctgttactacaacaactacagcttgacacagcctcgttacttttgca 187
||||| |||||||| |||||||||||||||||| | ||||| ||| | ||||| ||||
Sbjct: 406 aacaccaagttctgctactacaacaactacagcctcacacaacctagatacttctgca 463
>gnl|LJGI|TC72546 similar to UniRef100_Q76KU9 Cluster: DNA binding with one finger 5
protein; n=1; Pisum sativum|Rep: DNA binding with one
finger 5 protein - Pisum sativum (Garden pea), partial
(37%)
Length = 725
Score = 52.0 bits (26), Expect = 6e-06
Identities = 41/46 (89%)
Strand = Plus / Plus
Query: 115 cgctgtgactccatgaacacaaagttctgttactacaacaactaca 160
||||| ||||||| ||||| |||||||| ||||||||||||||||
Sbjct: 497 cgctgcgactccacaaacaccaagttctgctactacaacaactaca 542