Miyakogusa Predicted Gene

Lj6g3v1995740.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v1995740.2 CUFF.60410.2
         (1104 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC79159 UniRef100_A4PIZ3 Cluster: Cysteine proteinase; ...    52   8e-06

>gnl|LJGI|TC79159 UniRef100_A4PIZ3 Cluster: Cysteine proteinase; n=1; Lotus
           japonicus|Rep: Cysteine proteinase - Lotus japonicus,
           complete
          Length = 1243

 Score = 52.0 bits (26), Expect = 8e-06
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 940 gattattggatagtaaagaattcatggggt 969
           |||||||||||||| |||||||||||||||
Sbjct: 935 gattattggatagtgaagaattcatggggt 964