Miyakogusa Predicted Gene

Lj6g3v1966480.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v1966480.1 Non Chatacterized Hit- tr|I1M1L8|I1M1L8_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.5124 PE=,80,0,seg,NULL;
no description,Peptidase S8/S53, subtilisin/kexin/sedolisin; no
description,NULL; SUBTILIS,CUFF.60329.1
         (2376 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO012299 similar to UniRef100_A2Q1V2 Cluster: Peptidase...    54   4e-06

>gnl|LJGI|GO012299 similar to UniRef100_A2Q1V2 Cluster: Peptidase S8 and S53,
            subtilisin, kexin, sedolisin; n=1; Medicago
            truncatula|Rep: Peptidase S8 and S53, subtilisin, kexin,
            sedolisin - Medicago truncatula (Barrel medic), partial
            (26%)
          Length = 729

 Score = 54.0 bits (27), Expect = 4e-06
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                           
Query: 1726 ggaacttcaatgtcttgccctcatgtttctg 1756
            |||||||| ||||||||||||||||||||||
Sbjct: 391  ggaacttccatgtcttgccctcatgtttctg 421