Miyakogusa Predicted Gene

Lj6g3v1915780.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v1915780.1 Non Chatacterized Hit- tr|A5ADU7|A5ADU7_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,41.88,6e-18,sensory_box: PAS domain S-box protein,PAS domain;
PAS_9,NULL; PYP-like sensor domain (PAS
domain),NU,NODE_55088_length_1043_cov_63.962608.path2.1
         (948 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS338219 similar to UniRef100_A2Q2W0 Cluster: PAS; n=1;...   101   8e-21

>gnl|LJGI|FS338219 similar to UniRef100_A2Q2W0 Cluster: PAS; n=1; Medicago
           truncatula|Rep: PAS - Medicago truncatula (Barrel
           medic), partial (29%)
          Length = 677

 Score =  101 bits (51), Expect = 8e-21
 Identities = 117/139 (84%)
 Strand = Plus / Plus

                                                                       
Query: 239 agtatctcaatatcttgcagtcaatgggtcactctgttcatatacttgatcttcaatgtc 298
           ||||| ||||||| |||||||||||||| || |||||||||||| | |||| | | | ||
Sbjct: 356 agtatttcaatattttgcagtcaatgggacaatctgttcatatattggatcgtaactttc 415

                                                                       
Query: 299 gtatcgtgtactggaaccctagtgctgagaatctgtatggttatgcagcagctgaagttc 358
           ||||  | |||||||||| ||||||||||||||| ||||||||||||| ||  |||| ||
Sbjct: 416 gtataatttactggaaccatagtgctgagaatctatatggttatgcagaagaggaagctc 475

                              
Query: 359 ttggccatgatgggattga 377
           | ||||| || ||||||||
Sbjct: 476 taggccaagaagggattga 494



 Score = 65.9 bits (33), Expect = 4e-10
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 58  ggtcacgttcacctcaagcaagaaatgtccaagctcaagct 98
           ||||| ||| |||||||||||||||||||||||||||||||
Sbjct: 130 ggtcatgtttacctcaagcaagaaatgtccaagctcaagct 170