Miyakogusa Predicted Gene

Lj6g3v1915770.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v1915770.1 Non Chatacterized Hit- tr|I1MRR0|I1MRR0_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.34618
PE,82.81,0,TYRKINASE,Serine-threonine/tyrosine-protein kinase
catalytic domain; MAP3K DELTA-1 PROTEIN
KINASE,Se,NODE_57911_length_1536_cov_72.676430.path2.1
         (1155 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO012984 similar to UniRef100_A2Q2V9 Cluster: Protein k...   680   0.0  
gnl|LJGI|TC61380 similar to UniRef100_Q93XL9 Cluster: CTR1-like ...    60   3e-08
gnl|LJGI|TC63662 similar to UniRef100_O23719 Cluster: MAP3K delt...    56   5e-07

>gnl|LJGI|GO012984 similar to UniRef100_A2Q2V9 Cluster: Protein kinase; n=1; Medicago
            truncatula|Rep: Protein kinase - Medicago truncatula
            (Barrel medic), partial (40%)
          Length = 632

 Score =  680 bits (343), Expect = 0.0
 Identities = 346/347 (99%)
 Strand = Plus / Plus

                                                                        
Query: 809  ggatggcgcctgaagttcttcgtaacgaaccctctgatgagaagtctgacgtttacagct 868
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1    ggatggcgcctgaagttcttcgtaacgaaccctctgatgagaagtctgacgtttacagct 60

                                                                        
Query: 869  ttggggtgatattgtgggaacttgcgactgaaaagatcccttgggatactctcaatacaa 928
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 61   ttggggtgatattgtgggaacttgcgactgaaaagatcccttgggatactctcaacacaa 120

                                                                        
Query: 929  tgcaggttattggagctgttggttttatgaacaatcggctagaaattccagaagatgttg 988
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121  tgcaggttattggagctgttggttttatgaacaatcggctagaaattccagaagatgttg 180

                                                                        
Query: 989  atccacagtgggcttctataatagagggttgctggcaaagcgatccagcttgccgaccaa 1048
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181  atccacagtgggcttctataatagagggttgctggcaaagcgatccagcttgccgaccaa 240

                                                                        
Query: 1049 gtttccgggaactgttagataggcttagagaactgcagagacggtacgccattcagttcc 1108
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241  gtttccgggaactgttagataggcttagagaactgcagagacggtacgccattcagttcc 300

                                                           
Query: 1109 aggcagccagatctaatggtggggaaggcgcccaaaaggattcatag 1155
            |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301  aggcagccagatctaatggtggggaaggcgcccaaaaggattcatag 347


>gnl|LJGI|TC61380 similar to UniRef100_Q93XL9 Cluster: CTR1-like protein kinase; n=2;
           Rosa hybrid cultivar|Rep: CTR1-like protein kinase -
           Rosa hybrid cultivar, partial (14%)
          Length = 1189

 Score = 60.0 bits (30), Expect = 3e-08
 Identities = 72/86 (83%)
 Strand = Plus / Plus

                                                                       
Query: 808 tggatggcgcctgaagttcttcgtaacgaaccctctgatgagaagtctgacgtttacagc 867
           |||||||| || |||||||||||| | || || ||  ||||||||||||| |||||||||
Sbjct: 38  tggatggctccagaagttcttcgtgatgagccatcgaatgagaagtctgatgtttacagc 97

                                     
Query: 868 tttggggtgatattgtgggaacttgc 893
           |||||  | || |||||||| |||||
Sbjct: 98  tttggtataatcttgtgggagcttgc 123


>gnl|LJGI|TC63662 similar to UniRef100_O23719 Cluster: MAP3K delta-1 protein kinase;
           n=1; Arabidopsis thaliana|Rep: MAP3K delta-1 protein
           kinase - Arabidopsis thaliana (Mouse-ear cress), partial
           (66%)
          Length = 1516

 Score = 56.0 bits (28), Expect = 5e-07
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                       
Query: 926 caatgcaggttattggagctgttggttttatgaacaatcggctagaaattccagaagatg 985
           ||||||||||| ||||||||||||| ||    || || ||||| ||||||||||||||||
Sbjct: 869 caatgcaggttgttggagctgttggattccaaaataaacggcttgaaattccagaagatg 928

                   
Query: 986 ttgatcca 993
           | ||||||
Sbjct: 929 tggatcca 936