Miyakogusa Predicted Gene

Lj6g3v1887970.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v1887970.1 tr|G7JX91|G7JX91_MEDTR F-box/kelch-repeat protein
OS=Medicago truncatula GN=MTR_5g057710 PE=4
SV=1,32.67,0.00001,SUBFAMILY NOT NAMED,NULL; FAMILY NOT NAMED,NULL; no
description,NULL; FBOX,F-box domain, cyclin-like,gene.g66879.t1.1
         (1045 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP071391                                                      94   2e-18
gnl|LJGI|DC595381 weakly similar to UniRef100_Q2HS67 Cluster: Cy...    68   1e-10
gnl|LJGI|TC74128 similar to UniRef100_A7Q9Q9 Cluster: Chromosome...    68   1e-10
gnl|LJGI|GO011373 similar to UniRef100_A5GKE2 Cluster: Permease ...    62   7e-09
gnl|LJGI|TC82429 similar to UniRef100_Q2HWB4 Cluster: Cyclin-lik...    54   2e-06

>gnl|LJGI|BP071391 
          Length = 416

 Score = 93.7 bits (47), Expect = 2e-18
 Identities = 95/111 (85%)
 Strand = Plus / Minus

                                                                        
Query: 932  tttataactacagaaatggtgcgtctaggagtcctgatactgagtacaacacaagaattt 991
            ||||||| |||| ||||||  | |||||||||||||||||||| |||| ||||| |||||
Sbjct: 336  tttataattacataaatggcacttctaggagtcctgatactgaatacagcacaaaaattt 277

                                                               
Query: 992  tggaatggatggtcccacaacgctacattgagagtttagtatcaccttgtc 1042
             |||  ||||||||||| | |||||||||||||||||  ||||||| ||||
Sbjct: 276  cggaggggatggtcccataccgctacattgagagtttgatatcaccctgtc 226


>gnl|LJGI|DC595381 weakly similar to UniRef100_Q2HS67 Cluster: Cyclin-like F-box;
           F-box protein interaction domain; n=1; Medicago
           truncatula|Rep: Cyclin-like F-box; F-box protein
           interaction domain - Medicago truncatula (Barrel medic),
           partial (9%)
          Length = 408

 Score = 67.9 bits (34), Expect = 1e-10
 Identities = 79/94 (84%)
 Strand = Plus / Plus

                                                                       
Query: 211 aagtcttggaattccctcatttctgatcgcaaattcaccaaaaagcacctctatcggtca 270
           ||||| |||||||||||||| || |||| ||||||| ||| ||| ||||||  ||| |||
Sbjct: 182 aagtcctggaattccctcatctccgatcccaaattcgccagaaaccacctccgtcgttca 241

                                             
Query: 271 tcaatgaatcccacccgccatcgccttattttca 304
           ||| |||| |||||||| || ||||| |||||||
Sbjct: 242 tcagtgaaccccacccgtcaccgcctcattttca 275


>gnl|LJGI|TC74128 similar to UniRef100_A7Q9Q9 Cluster: Chromosome chr5 scaffold_67,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr5 scaffold_67, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (9%)
          Length = 501

 Score = 67.9 bits (34), Expect = 1e-10
 Identities = 52/58 (89%)
 Strand = Plus / Plus

                                                                     
Query: 202 tgcgtatgcaagtcttggaattccctcatttctgatcgcaaattcaccaaaaagcacc 259
           ||||| |||||||| ||||||||||| |||||||||| ||||||| ||| ||||||||
Sbjct: 250 tgcgtctgcaagtcctggaattccctgatttctgatcccaaattcgccagaaagcacc 307


>gnl|LJGI|GO011373 similar to UniRef100_A5GKE2 Cluster: Permease of the
           drug/metabolite transporter (DMT) superfamily; n=1;
           Synechococcus sp. WH 7803|Rep: Permease of the
           drug/metabolite transporter (DMT) superfamily -
           Synechococcus sp. (strain WH7803), partial (7%)
          Length = 738

 Score = 61.9 bits (31), Expect = 7e-09
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 799 atgaatgagtatggaaataaagactcttggaccaaattattcagtgttcct 849
           ||||| ||||||||||||||||| || ||||||||| | ||||||||||||
Sbjct: 439 atgaaggagtatggaaataaagagtcctggaccaaaattttcagtgttcct 489


>gnl|LJGI|TC82429 similar to UniRef100_Q2HWB4 Cluster: Cyclin-like F-box; F-box
           protein interaction domain; n=1; Medicago
           truncatula|Rep: Cyclin-like F-box; F-box protein
           interaction domain - Medicago truncatula (Barrel medic),
           partial (5%)
          Length = 542

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 799 atgaatgagtatggaaataaagactcttggaccaaattattcagtgt 845
           ||||| |||||||||||| || | |||||||| ||||||||||||||
Sbjct: 61  atgaaggagtatggaaatcaacagtcttggactaaattattcagtgt 107