Miyakogusa Predicted Gene
- Lj6g3v1887970.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj6g3v1887970.1 tr|G7JX91|G7JX91_MEDTR F-box/kelch-repeat protein
OS=Medicago truncatula GN=MTR_5g057710 PE=4
SV=1,32.67,0.00001,SUBFAMILY NOT NAMED,NULL; FAMILY NOT NAMED,NULL; no
description,NULL; FBOX,F-box domain, cyclin-like,gene.g66879.t1.1
(1045 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BP071391 94 2e-18
gnl|LJGI|DC595381 weakly similar to UniRef100_Q2HS67 Cluster: Cy... 68 1e-10
gnl|LJGI|TC74128 similar to UniRef100_A7Q9Q9 Cluster: Chromosome... 68 1e-10
gnl|LJGI|GO011373 similar to UniRef100_A5GKE2 Cluster: Permease ... 62 7e-09
gnl|LJGI|TC82429 similar to UniRef100_Q2HWB4 Cluster: Cyclin-lik... 54 2e-06
>gnl|LJGI|BP071391
Length = 416
Score = 93.7 bits (47), Expect = 2e-18
Identities = 95/111 (85%)
Strand = Plus / Minus
Query: 932 tttataactacagaaatggtgcgtctaggagtcctgatactgagtacaacacaagaattt 991
||||||| |||| |||||| | |||||||||||||||||||| |||| ||||| |||||
Sbjct: 336 tttataattacataaatggcacttctaggagtcctgatactgaatacagcacaaaaattt 277
Query: 992 tggaatggatggtcccacaacgctacattgagagtttagtatcaccttgtc 1042
||| ||||||||||| | ||||||||||||||||| ||||||| ||||
Sbjct: 276 cggaggggatggtcccataccgctacattgagagtttgatatcaccctgtc 226
>gnl|LJGI|DC595381 weakly similar to UniRef100_Q2HS67 Cluster: Cyclin-like F-box;
F-box protein interaction domain; n=1; Medicago
truncatula|Rep: Cyclin-like F-box; F-box protein
interaction domain - Medicago truncatula (Barrel medic),
partial (9%)
Length = 408
Score = 67.9 bits (34), Expect = 1e-10
Identities = 79/94 (84%)
Strand = Plus / Plus
Query: 211 aagtcttggaattccctcatttctgatcgcaaattcaccaaaaagcacctctatcggtca 270
||||| |||||||||||||| || |||| ||||||| ||| ||| |||||| ||| |||
Sbjct: 182 aagtcctggaattccctcatctccgatcccaaattcgccagaaaccacctccgtcgttca 241
Query: 271 tcaatgaatcccacccgccatcgccttattttca 304
||| |||| |||||||| || ||||| |||||||
Sbjct: 242 tcagtgaaccccacccgtcaccgcctcattttca 275
>gnl|LJGI|TC74128 similar to UniRef100_A7Q9Q9 Cluster: Chromosome chr5 scaffold_67,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr5 scaffold_67, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (9%)
Length = 501
Score = 67.9 bits (34), Expect = 1e-10
Identities = 52/58 (89%)
Strand = Plus / Plus
Query: 202 tgcgtatgcaagtcttggaattccctcatttctgatcgcaaattcaccaaaaagcacc 259
||||| |||||||| ||||||||||| |||||||||| ||||||| ||| ||||||||
Sbjct: 250 tgcgtctgcaagtcctggaattccctgatttctgatcccaaattcgccagaaagcacc 307
>gnl|LJGI|GO011373 similar to UniRef100_A5GKE2 Cluster: Permease of the
drug/metabolite transporter (DMT) superfamily; n=1;
Synechococcus sp. WH 7803|Rep: Permease of the
drug/metabolite transporter (DMT) superfamily -
Synechococcus sp. (strain WH7803), partial (7%)
Length = 738
Score = 61.9 bits (31), Expect = 7e-09
Identities = 46/51 (90%)
Strand = Plus / Plus
Query: 799 atgaatgagtatggaaataaagactcttggaccaaattattcagtgttcct 849
||||| ||||||||||||||||| || ||||||||| | ||||||||||||
Sbjct: 439 atgaaggagtatggaaataaagagtcctggaccaaaattttcagtgttcct 489
>gnl|LJGI|TC82429 similar to UniRef100_Q2HWB4 Cluster: Cyclin-like F-box; F-box
protein interaction domain; n=1; Medicago
truncatula|Rep: Cyclin-like F-box; F-box protein
interaction domain - Medicago truncatula (Barrel medic),
partial (5%)
Length = 542
Score = 54.0 bits (27), Expect = 2e-06
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 799 atgaatgagtatggaaataaagactcttggaccaaattattcagtgt 845
||||| |||||||||||| || | |||||||| ||||||||||||||
Sbjct: 61 atgaaggagtatggaaatcaacagtcttggactaaattattcagtgt 107